AMCG00001313 (si:ch211-114n24.6,LOC106598125,LOC107581392,LOC107659949,LOC108433351,LOC103467923,LOC102313992,LOC104949664,LOC106573846)


Basic Information

Item Value
gene id AMCG00001313
gene name si:ch211-114n24.6,LOC106598125,LOC107581392,LOC107659949,LOC108433351,LOC103467923,LOC102313992,LOC104949664,LOC106573846
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030137.1
NCBI id CM030137.1
chromosome length 27060302
location 24447621 ~ 24455129 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00001313
ATGTCCAGACAGTGGCGGAGGCTGCTGCTTTATAGCACCAGAAGAGCTGCAGAGCTAGGCAACCAGCTTGTGTTGTTGGTCCACAAAGACAGCACGGGGGACGTGCTTGCCTGCCCCTGTCTCACTGAAGAAGGTGTTGAAGGAGTCGTCCCCTCCTCCGATGGTCTTGTCACTGGGCATCTGACCATCAGGCTGGATCCCGTGCTCCAGACAGTACAACTCCCAGCAGGCATTGCCCATCTGGACTCCGGCTTGGCCGACATGGATGGAGATACACTCTCG

Function

symbol description
si:ch211-114n24.6 Predicted to enable GTP binding activity. Predicted to be a structural constituent of cytoskeleton. Predicted to be involved in microtubule cytoskeleton organization and mitotic cell cycle. Predicted to act upstream of or within microtubule-based process. Predicted to be located in cytoskeleton. Predicted to be active in cytoplasm and microtubule.

NR:

description
PREDICTED: tubulin alpha chain-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00001313 True 282 mRNA 0.57 2 24447621 24455129

Neighbor

gene id symbol gene type direction distance location
AMCG00001302 ptprn,ptprnb,LOC107748541 coding upstream 95974 24322671 ~ 24351647 (+)
AMCG00001309 NA coding upstream 160986 24256836 ~ 24286635 (+)
AMCG00001299 dnpep,LOC106573845 coding upstream 240000 24180250 ~ 24207621 (+)
AMCG00001297 tmem198a coding upstream 356772 24072429 ~ 24090849 (+)
AMCG00001298 NA coding upstream 457539 23948449 ~ 23990082 (+)
AMCG00001311 tuba8l2,LOC108411703,LOC103042625,LOC107750365 coding downstream 25840 24480969 ~ 24490636 (+)
AMCG00001310 stk16,LOC107676064,LOC107674016,LOC107750071,LOC107750290 coding downstream 41529 24496658 ~ 24502375 (+)
AMCG00001314 NA coding downstream 113236 24568365 ~ 24576371 (+)
AMCG00001317 NA coding downstream 190723 24645852 ~ 24659929 (+)
AMCG00001319 NA coding downstream 247514 24702643 ~ 24861705 (+)
G130552 NA non-coding upstream 327160 24052822 ~ 24120461 (+)
G130530 NA non-coding upstream 521610 23924878 ~ 23926011 (+)
G130531 NA non-coding upstream 523744 23923211 ~ 23923877 (+)
G130492 NA non-coding upstream 591505 23855720 ~ 23856116 (+)
G130461 NA non-coding upstream 718392 23729005 ~ 23729229 (+)
G130648 NA non-coding downstream 295990 24751119 ~ 24751414 (+)
G130684 NA non-coding downstream 567550 25022679 ~ 25023049 (+)
G130689 NA non-coding downstream 601492 25056621 ~ 25056978 (+)
G130692 NA non-coding downstream 631532 25086661 ~ 25086898 (+)
G130695 NA non-coding downstream 668465 25123594 ~ 25126079 (+)
AMCG00001312 tuba4a,tuba8l4,tba1a,si:ch211-114n24.6,LOC108251627,LOC107714908 other upstream 1388 24424565 ~ 24446233 (+)
AMCG00001292 ndufs1,LOC107555450,LOC107748553 other upstream 762500 23565151 ~ 23685121 (+)
G130335 NA other upstream 1280965 23166263 ~ 23166656 (+)
AMCG00001278 ercc3,LOC107706662 other upstream 1916785 22500035 ~ 22530836 (+)
AMCG00001269 trak2,LOC107582328,LOC106573853 other upstream 2208967 22189908 ~ 22238654 (+)
AMCG00001315 NA other downstream 129050 24584179 ~ 24606472 (+)
AMCG00001331 NA other downstream 968558 25423687 ~ 25450310 (+)
AMCG00001337 sumo1 other downstream 1280426 25735555 ~ 25749501 (+)
AMCG00001361 NA other downstream 2401470 26856599 ~ 26880797 (+)
AMCG00001365 NA other downstream 2449234 26904363 ~ 26954597 (+)

Expression


Co-expression Network