AMCG00005003 (st6galnac3,LOC106569362,LOC107735094)


Basic Information

Item Value
gene id AMCG00005003
gene name st6galnac3,LOC106569362,LOC107735094
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030140.1
NCBI id CM030140.1
chromosome length 22460246
location 11603594 ~ 11619275 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00005003
ATGAGTTTGATAGTGGCCGTGTCTCTGTTCGTTGTGGTGGTCAATTACACGGAGAAGCCCTACATCTTACTGCAGCCAGTCTTTGGACAGACTTTCAGCAACCGATGGGTCTTTTCTCGTCTGCAGCACAAGAACTTGAAACCACACCTGGGTTACGTCAGCGTCCCAAAACAAGAGCCTCTCAAGCTTAACTGCGACGTGTGCAGTGTGGTGTCCAGCTCGGGCCAGATGTTGGACCGGGAGGCGGGCTGGGAGATTGACCAGTCGTCCTGCGTGTTGAGGATGAACAATGCGCCCACCAAGGGCTTCGAGACGGACGTGGGCAGGAGGACCACGCTCAGGGTGGTCTCCCACACCAGCGTACCTCTCCTCTTGCAGAAGCAGCAGTACTTCTTCGGGCAGGCCAACGACACCGTGTATGTCATCTGGGGTCCTCTGCGCAACATGAGGAAAGACGGCAAAGGCATTGTGTACAACATGCTGAGGCAGGTGATGGACAACTATCCCCAGGCCAAGATCTTTGTGACCACGGAGGAGAGAATGAACTACTGTGACAAGGTGTTCAAAGAGGAGACCGGGAAAGATAGGACCAAAGCTCTGCATTCTCCCAAAAACGATCTCTGCTTGTTCCCCTGTGTGCCCTCCCTGCTGTGA

Function

symbol description
st6galnac3 Predicted to enable alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity. Predicted to be involved in ganglioside biosynthetic process and oligosaccharide metabolic process. Predicted to act upstream of or within protein glycosylation. Predicted to be located in Golgi apparatus and membrane. Predicted to be integral component of membrane. Is expressed in brain; heart; and intestine. Orthologous to human ST6GALNAC3 (ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 3).

NR:

description
PREDICTED: alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00005003 True 654 mRNA 0.54 3 11603594 11619275

Neighbor

gene id symbol gene type direction distance location
AMCG00004994 st6galnac3 coding downstream 23408 11577070 ~ 11580186 (-)
AMCG00004998 st6galnac5,LOC103370426 coding downstream 78405 11510220 ~ 11525189 (-)
AMCG00004999 ak5,LOC102787869 coding downstream 141092 11451742 ~ 11462502 (-)
AMCG00004997 NA coding downstream 165412 11412899 ~ 11438182 (-)
AMCG00004972 NA coding downstream 242041 11343332 ~ 11361553 (-)
AMCG00005000 acadm,LOC107674066,LOC107602542,LOC107688505,LOC107584839 coding upstream 50145 11669420 ~ 11681466 (-)
AMCG00004996 lhx8,lhx8a,LOC108436043 coding upstream 168360 11787635 ~ 11796676 (-)
AMCG00004995 NA coding upstream 213174 11832449 ~ 11835534 (-)
AMCG00005001 tnni3k,LOC107550356,LOC107743849,LOC107657874,LOC107699804,LOC105895228,LOC107710912 coding upstream 233636 11852911 ~ 11879255 (-)
AMCG00005002 NA coding upstream 260580 11879855 ~ 11882707 (-)
G144672 NA non-coding downstream 31184 11571190 ~ 11572410 (-)
G144659 NA non-coding downstream 97592 11505678 ~ 11506002 (-)
G144657 NA non-coding downstream 102519 11499172 ~ 11501075 (-)
G144614 NA non-coding downstream 275113 11322583 ~ 11328481 (-)
G144612 fubp1 non-coding downstream 281588 11319126 ~ 11322006 (-)
G144821 NA non-coding upstream 390643 12009918 ~ 12010371 (-)
G144826 NA non-coding upstream 404239 12023514 ~ 12029449 (-)
G144877 toe1,LOC107579611 non-coding upstream 683304 12302579 ~ 12302836 (-)
G144878 NA non-coding upstream 683690 12302965 ~ 12303263 (-)
G144879 NA non-coding upstream 684136 12303411 ~ 12303620 (-)
G144115 LOC108413222,LOC107749977,LOC107730703,LOC107698886,LOC107675437,LOC107564626 other downstream 2697000 8872885 ~ 8906594 (-)
AMCG00004894 kat3,kyat3,ccbl2,LOC100332215 other downstream 2755819 8836360 ~ 8847775 (-)
G144050 selenof,LOC106598901 other downstream 3226593 8353989 ~ 8377001 (-)
G143659 NA other downstream 5820410 5736809 ~ 5783184 (-)
AMCG00004819 zbtb37,LOC106613586 other downstream 7487180 4109082 ~ 4116414 (-)
AMCG00005011 best4,LOC103396708 other upstream 516103 12135378 ~ 12156378 (-)
AMCG00005022 NA other upstream 725396 12344671 ~ 12348328 (-)
G145046 NA other upstream 1716934 13336209 ~ 13336746 (-)
AMCG00005077 arpc5,arpc5b,LOC103032016,LOC108431159,LOC107698380,LOC104921830 other upstream 3345139 14964414 ~ 14969242 (-)
AMCG00005111 NA other upstream 3883807 15503082 ~ 15535145 (-)

Expression


Co-expression Network