AMCG00014106


Basic Information

Item Value
gene id AMCG00014106
gene name NA
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030128.1
NCBI id CM030128.1
chromosome length 42883965
location 1921339 ~ 1925062 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00014106
ATGGCCTGGTCTGACTTAGCTGCGAAACAGTTTGGATTCCCAGACATCGAGCTCTTTGTTAAGGCGGGCAGTGATGGGGAGAGCATTGGCAACTGCCCCTTCTCGCAGCGCCTCTTCATGATCCTGTGGCTGAAGGGAGTGATCTTCAACGTGACCACCGTGGACCTGAAGAGGAAGCCGGCCGACCTGCAGGACCTGGCCCCGGGGACCAACCCCCCCTTCGTCACCTTCAATGGTGAGGTGAAGACAGACGTCAACAAGATCGAGGAGTTCCTGGAGGAGAAGCTGCTGCCCCCTCGCGCCGACGAGCCGTCTGCCTCCTGCCGCAGCTTCCTGGACGGAGAGGAGCTCACGCTAGCCGACTGCAACCTGCTGCCCAAGCTGCACATCATCAAGGTGGTGGCGTGGAAATACCGTGGGTTCAAGATCCCGGTGGAGATGGAGGGCGTGTGGCGCTACCTGCACAGCGCATACCGCCGGGAGGATCTCGGTTAA

Function

GO:

id name namespace
GO:0051963 regulation of synapse assembly biological_process
GO:0051965 positive regulation of synapse assembly biological_process
GO:0050807 regulation of synapse organization biological_process
GO:0050808 synapse organization biological_process
GO:0007416 synapse assembly biological_process

KEGG:

id description
ko04514 Cell adhesion molecules
ko04727 GABAergic synapse
ko05032 Morphine addiction

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00014106 True 495 mRNA 0.60 6 1921339 1925062

Neighbor

gene id symbol gene type direction distance location
AMCG00014103 NA coding upstream 42379 1872749 ~ 1878960 (+)
AMCG00014102 app coding upstream 51897 1858678 ~ 1869442 (+)
AMCG00014101 NA coding upstream 87979 1825855 ~ 1833360 (+)
AMCG00014100 NA coding upstream 108041 1799682 ~ 1813298 (+)
AMCG00014095 NA coding upstream 356765 1545327 ~ 1564574 (+)
AMCG00014112 NA coding downstream 83540 2008602 ~ 2022266 (+)
AMCG00014113 NA coding downstream 99536 2024598 ~ 2028511 (+)
AMCG00014120 NA coding downstream 158364 2083426 ~ 2113366 (+)
AMCG00014124 NA coding downstream 236695 2161757 ~ 2172540 (+)
AMCG00014122 NA coding downstream 254584 2179646 ~ 2195573 (+)
G67789 NA non-coding upstream 78894 1840165 ~ 1842445 (+)
G67792 NA non-coding upstream 99581 1820573 ~ 1821758 (+)
G67699 NA non-coding upstream 645123 1275991 ~ 1276216 (+)
G67698 NA non-coding upstream 671025 1250099 ~ 1250314 (+)
G67690 NA non-coding upstream 898526 981839 ~ 1022813 (+)
G67882 NA non-coding downstream 152241 2077303 ~ 2077602 (+)
G67899 NA non-coding downstream 223387 2148449 ~ 2148654 (+)
G67907 NA non-coding downstream 408429 2333491 ~ 2333944 (+)
G67908 NA non-coding downstream 425067 2350129 ~ 2373305 (+)
G67983 NA non-coding downstream 821182 2746244 ~ 2755484 (+)
AMCG00014111 NA other upstream 18652 1900220 ~ 1902687 (+)
G67801 NA other upstream 40298 1879091 ~ 1881041 (+)
AMCG00014104 cyyr1,LOC107751099 other upstream 83214 1835432 ~ 1838125 (+)
AMCG00014099 NA other upstream 423735 1479919 ~ 1497604 (+)
AMCG00014061 NA other upstream 1674337 136864 ~ 247002 (+)
G67896 NA other downstream 201810 2126872 ~ 2130145 (+)
AMCG00014146 NA other downstream 781778 2706840 ~ 2710329 (+)
AMCG00014196 NA other downstream 2202414 4127476 ~ 4131718 (+)
G68475 NA other downstream 2724138 4649200 ~ 4651964 (+)
G68830 NA other downstream 5421133 7346195 ~ 7349467 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
grasscarp (Ctenopharyngodon idella) CI01000312_00203359_00208140 CLIC4 coding CI01000312 null 201999 ~ 208140 (-)