AMCG00014201 (rab9a,LOC106581920)


Basic Information

Item Value
gene id AMCG00014201
gene name rab9a,LOC106581920
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030128.1
NCBI id CM030128.1
chromosome length 42883965
location 4290944 ~ 4291549 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00014201
ATGGCAGCAAAATCATCCCTGCTCAAAGTCATCCTGCTGGGAGATGGTGGAGTCGGCAAGAGCTCCCTCATGAACCGCTACGTCACCAACAAGTTCGACACCCACCTCTTCCACACCATCGGCGTGGAGTTCCTGAACAAGGACCTGGAGGTGGACGGACACTTCGTCACTATGCAGATCTGGGACACGGCCGGCCAGGAGCGCTTCCGGAGCCTGAGGACTCCCTTTTACCGCGGCTCCGACTGCTGCCTCCTCACGTTCAGCGTGGACGACAGCCAGAGCTTCCAGAACCTCAGCAACTGGAAGAAGGAGTTCATCTACTACGCGGACGTCAAGGAGCCGGAGAGCTTCCCCTTCGTGGTCCTCGGGAATAAGATCGACGTCACGGAGCGGCAGGTCTCCACGGAGGAGGCGCAGCTGTGGTGCAGGGAGAACGGCAACCACCCGTATTTCGAAACCAGTGCCAAGGACTCCACCAACGTGGCCGTGGCGTTCGAAGAGGCGGTGCGCAGAGTCCTGGCCACGGAGGACCGGACGGAACATCTCATCCCCACGGACACTGTCAACCTCCATAGAAAGCCCAAGTCTAGCTCTTCCTGTTGTTGA

Function

symbol description
rab9a Predicted to enable GTP binding activity and GTPase activity. Predicted to be involved in retrograde transport, endosome to Golgi. Predicted to act upstream of or within Rab protein signal transduction. Predicted to be located in phagocytic vesicle membrane. Predicted to be active in late endosome; lysosome; and phagocytic vesicle. Orthologous to human RAB9A (RAB9A, member RAS oncogene family).

NR:

description
ras-related protein Rab-9A

GO:

id name namespace
GO:0007264 small GTPase mediated signal transduction biological_process
GO:0015031 protein transport biological_process
GO:0005525 GTP binding molecular_function

KEGG:

id description
K07899 RAB9A, RAB9; Ras-related protein Rab-9A

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00014201 True 606 mRNA 0.59 1 4290944 4291549

Neighbor

gene id symbol gene type direction distance location
AMCG00014200 NA coding upstream 46922 4242810 ~ 4244022 (+)
AMCG00014198 NA coding upstream 63301 4223544 ~ 4227643 (+)
AMCG00014199 NA coding upstream 70820 4205155 ~ 4220124 (+)
AMCG00014197 NA coding upstream 172172 4106184 ~ 4118772 (+)
AMCG00014195 prps2 coding upstream 192003 4088363 ~ 4098941 (+)
AMCG00014202 NA coding downstream 6792 4298341 ~ 4316679 (+)
AMCG00014207 LOC108443135,LOC102799111 coding downstream 169226 4460775 ~ 4498956 (+)
AMCG00014209 NA coding downstream 229253 4520802 ~ 4548407 (+)
AMCG00014208 NA coding downstream 277120 4568669 ~ 4583209 (+)
AMCG00014213 anos1,LOC104963477 coding downstream 432105 4723654 ~ 4746002 (+)
G68317 NA non-coding upstream 206980 4083763 ~ 4083964 (+)
G68292 NA non-coding upstream 335679 3954366 ~ 3955265 (+)
G68189 NA non-coding upstream 807295 3410978 ~ 3483649 (+)
G68167 NA non-coding upstream 915155 3375585 ~ 3375789 (+)
G68166 NA non-coding upstream 915796 3374837 ~ 3375148 (+)
G68374 NA non-coding downstream 1777 4293326 ~ 4293526 (+)
G68376 trappc2 non-coding downstream 3268 4294817 ~ 4295819 (+)
G68422 NA non-coding downstream 209315 4500864 ~ 4550002 (+)
G68434 NA non-coding downstream 292925 4584474 ~ 4588428 (+)
G68473 NA non-coding downstream 356161 4647710 ~ 4648213 (+)
AMCG00014196 NA other upstream 159226 4127476 ~ 4131718 (+)
AMCG00014146 NA other upstream 1580615 2706840 ~ 2710329 (+)
G67896 NA other upstream 2160799 2126872 ~ 2130145 (+)
AMCG00014111 NA other upstream 2388257 1900220 ~ 1902687 (+)
G67801 NA other upstream 2409903 1879091 ~ 1881041 (+)
G68475 NA other downstream 357651 4649200 ~ 4651964 (+)
G68830 NA other downstream 3054646 7346195 ~ 7349467 (+)
G68848 NA other downstream 3122091 7413640 ~ 7416594 (+)
AMCG00014272 tbc1d23 other downstream 3172954 7464503 ~ 7482560 (+)
G69406 tgfbrap1,LOC102780916 other downstream 5711509 10003058 ~ 10008648 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
grasscarp (Ctenopharyngodon idella) CI01000201_00576577_00577506 NA coding CI01000201 null 576577 ~ 578901 (+)