AMCG00014648 (hs6st3,LOC105898056,LOC102202054,LOC101476457,LOC100690379)


Basic Information

Item Value
gene id AMCG00014648
gene name hs6st3,LOC105898056,LOC102202054,LOC101476457,LOC100690379
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030128.1
NCBI id CM030128.1
chromosome length 42883965
location 25245413 ~ 25245961 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00014648
ATGGATGATAAATCCAATAAGCTGATCCTGGTTCCCATTTTAGCCGTGCTGTTTGTGATGATAGGTTATCAGTATATCTGTCCAGCTGGCAGCAACTCTTGCCACTTCAGGACCGGGGAGAAGTTGAGGGGCATCACTCCTCCAACAACCCAGTCTCCGCCGAGCGCCGATTTCTACCGAGACCAAGAGCTGGAAGAAGACTGCCCTCCCAAATTCGTGCCCAGATTCAACTTCACCGAGAAAGACCTGAAGCGGTACGTGGATTTCAACATCAAGGGGGACGATGTGATTGTGTTCCTGCACATCCAGAAGACGGGGGGGACCACGTTTGGCAGGCATCTGGTGAGGAATATCCGTCTGGAGCAGCCGTGCGATTGCAAACCCGGCCAGAAGAAATGCACCTGTCACCGACCCGGCAAACAGGAGTCCTGGCTGTTCTCCCGATTCTCCACCGGCTGGAGCTGCGGTCTGCACGCCGACTGGACCGAGCTGACCAACTGCGTGCCGGTCATCATGGACAAAAAGGAAGCCCAGAAGATCCGGAGGTGA

Function

symbol description
hs6st3 Predicted to enable heparan sulfate 6-O-sulfotransferase activity. Predicted to be involved in heparan sulfate proteoglycan biosynthetic process, enzymatic modification. Predicted to be integral component of membrane.

NR:

description
PREDICTED: heparan-sulfate 6-O-sulfotransferase 3-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00014648 True 549 mRNA 0.55 1 25245413 25245961

Neighbor

gene id symbol gene type direction distance location
AMCG00014644 dnajc3 coding upstream 81778 25149803 ~ 25163635 (+)
AMCG00014646 NA coding upstream 119368 25124094 ~ 25126045 (+)
AMCG00014643 NA coding upstream 142775 25087014 ~ 25102638 (+)
AMCG00014637 NA coding upstream 307448 24928031 ~ 24937965 (+)
AMCG00014638 NA coding upstream 348404 24888533 ~ 24897009 (+)
AMCG00014649 LOC105024749,LOC106586266,LOC106582445 coding downstream 127425 25373386 ~ 25374072 (+)
AMCG00014651 mbnl2,LOC107677847,LOC107653675,LOC107555253,LOC107559795 coding downstream 233830 25479791 ~ 25505003 (+)
AMCG00014653 rap2a,LOC101166017,LOC106512668,LOC105907999,LOC105933629,LOC100695037,LOC103391592,LOC106582448 coding downstream 276265 25522226 ~ 25530849 (+)
AMCG00014652 NA coding downstream 319196 25565157 ~ 25574008 (+)
AMCG00014654 kpnb3,ipo5,LOC107677849 coding downstream 329279 25575240 ~ 25592567 (+)
G71670 NA non-coding upstream 136035 25109156 ~ 25109378 (+)
G71662 NA non-coding upstream 162535 25082659 ~ 25082878 (+)
G71598 NA non-coding upstream 712452 24523645 ~ 24532961 (+)
G71596 NA non-coding upstream 912116 24332431 ~ 24333297 (+)
G71584 NA non-coding upstream 1336764 23908385 ~ 23908649 (+)
G71725 NA non-coding downstream 287381 25533342 ~ 25534154 (+)
G71763 NA non-coding downstream 459497 25705458 ~ 25762742 (+)
G71772 NA non-coding downstream 499842 25745803 ~ 25748408 (+)
G71784 NA non-coding downstream 524248 25770209 ~ 25770489 (+)
G71817 NA non-coding downstream 706272 25952233 ~ 25959702 (+)
G71525 NA other upstream 2389767 22855342 ~ 22855646 (+)
G71004 NA other upstream 6971053 18271854 ~ 18274360 (+)
AMCG00014553 atp1a1,LOC108429865,LOC106919873,LOC103358968,LOC102798469 other upstream 7758363 17364798 ~ 17487050 (+)
AMCG00014525 NA other upstream 8776204 16465621 ~ 16469209 (+)
AMCG00014508 NA other upstream 9106381 16129479 ~ 16139032 (+)
AMCG00014687 NA other downstream 1658916 26904877 ~ 26911237 (+)
AMCG00014704 fundc1,LOC102219358,LOC102292135,LOC102776203,LOC103475814,LOC106926458 other downstream 2589542 27835503 ~ 27841871 (+)
AMCG00014703 ndp,LOC107565935,LOC106586792 other downstream 2622742 27868703 ~ 27879800 (+)
G72175 LOC102776245 other downstream 3056412 28302373 ~ 28304073 (+)
AMCG00014729 NA other downstream 3551088 28797049 ~ 28837910 (+)

Expression


Co-expression Network