AMCG00014667 (pcca,LOC107719738,LOC107707835)


Basic Information

Item Value
gene id AMCG00014667
gene name pcca,LOC107719738,LOC107707835
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030128.1
NCBI id CM030128.1
chromosome length 42883965
location 26203883 ~ 26244458 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00014667
ATGGCGGACGAGGCTGTCTGTGTTGGCCCGGCTCCCACCAACAAAAGCTACCTTAACATGGATGCCATCATGGAGGCCATTAGGAAAACCGGAGCCCAAGCTGCAGCAGAAGGTGTCACCTTCATTGGACCTGACACACATGCTATCCAAGCCATGGGAGACAAGATTGAAAGCAAATTAATAGCCAAGAAGGCGAAGGTCAACACCATTCCAGGCTTTGATGGGGTGGTGAAGGATGCAGGCGAAGCTGTCAGAATTGCAGGGGAAATTGGCTACCCCGTCATGATCAAGGCATCAGCAGGTGGTGGAGGGAAAGGCATGAGGATAGCCTGGGATGATGAAGAGACCAGGGAAGGCTTCCGGTTTTCTTCTCAAGAAGCTGCTTCTAGTTTCGGAGATGATCGTCTCTTGATCGAGAAGTTTATCGATAACCCACGGCATATAGAAATACAAGTTCTTGCTGATAAGCATGGCAATGCCCTCTGGCTGAATGAAAGAGAGTGCTCCATTCAAAGAAGAAACCAAAAAGTGGTCGAGGAGGCACCGAGCACTTTCCTTGATCCTGAGACGCGGCGTGCGATGGGAGAGCAGGCGGTGTCCTTGGCGAGGGCAGTGCAGTATTCTTCAGCTGGCACCGTGGAATTCCTGGTGGACTCCAAGAGGAATTTCTACTTTTTGGAAATGAATACTCGCCTTCAGGTTGAACACCCCATCACCGAATGTATTACGGGCCTGGATTTAGTCCAAGAAATGATCCGAGTTGCCAAGGGTTACCCACTTCGACAAAAGCAGGCTGATATTCCCATTAACGGCTGGGCCCTTGAAAGCCGAGTGTACGCTGAGGATCCCTACAAATCCTTTGGCCTGCCTTCTATTGGTCGCCTCAACCAGTACCAGGAGCCTGTGAATCTGAGCAAGGTACGGTTCTAG

Function

symbol description
pcca Predicted to enable propionyl-CoA carboxylase activity. Predicted to act upstream of or within lipid catabolic process. Predicted to be active in mitochondrion. Is expressed in several structures, including alar plate midbrain region; immature eye; liver; optic tectum; and segmental plate. Human ortholog(s) of this gene implicated in amino acid metabolic disorder and propionic acidemia. Orthologous to human PCCA (propionyl-CoA carboxylase subunit alpha).

NR:

description
PREDICTED: propionyl-CoA carboxylase alpha chain, mitochondrial-like

GO:

id name namespace
GO:0008152 metabolic process biological_process
GO:0005524 ATP binding molecular_function
GO:0046872 metal ion binding molecular_function
GO:0004075 biotin carboxylase activity molecular_function

KEGG:

id description
K01965 PCCA, pccA; propionyl-CoA carboxylase alpha chain

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00014667 True 930 mRNA 0.51 9 26203883 26244458

Neighbor

gene id symbol gene type direction distance location
AMCG00014664 zic2,LOC106586042 coding upstream 31409 26168461 ~ 26172474 (+)
AMCG00014665 NA coding upstream 80115 26085859 ~ 26123768 (+)
AMCG00014660 tm9sf2,LOC106574826,LOC107705039,LOC107719731,LOC107654273,LOC107556717 coding upstream 151340 26036433 ~ 26052543 (+)
AMCG00014661 gpr18,LOC107740919,LOC107681324,LOC107600424,LOC107748622,LOC107668869 coding upstream 262340 25934481 ~ 25941543 (+)
AMCG00014655 LOC107559785 coding upstream 504955 25660345 ~ 25698928 (+)
AMCG00014668 pcca,LOC107654247 coding downstream 73573 26318031 ~ 26335361 (+)
AMCG00014669 LOC107748618 coding downstream 128766 26373224 ~ 26389223 (+)
AMCG00014670 NA coding downstream 144774 26389232 ~ 26409091 (+)
AMCG00014676 itgbl1,LOC107748609,LOC107690616,LOC107681304 coding downstream 341023 26585481 ~ 26588394 (+)
AMCG00014677 LOC107600373,LOC107569583,LOC107690616,LOC107748609,LOC107731761,LOC107681305 coding downstream 380303 26624761 ~ 26628707 (+)
G71826 NA non-coding upstream 192883 26010799 ~ 26011000 (+)
G71817 NA non-coding upstream 244181 25952233 ~ 25959702 (+)
G71784 NA non-coding upstream 433394 25770209 ~ 25770489 (+)
G71763 NA non-coding upstream 441141 25705458 ~ 25762742 (+)
G71963 NA non-coding downstream 707838 26952296 ~ 26953253 (+)
G71995 NA non-coding downstream 782317 27026775 ~ 27027272 (+)
G72072 NA non-coding downstream 1230606 27475064 ~ 27479444 (+)
G72169 NA non-coding downstream 1996108 28240566 ~ 28297484 (+)
G72173 NA non-coding downstream 2053211 28297669 ~ 28300813 (+)
G71525 NA other upstream 3348237 22855342 ~ 22855646 (+)
G71004 NA other upstream 7929523 18271854 ~ 18274360 (+)
AMCG00014553 atp1a1,LOC108429865,LOC106919873,LOC103358968,LOC102798469 other upstream 8716833 17364798 ~ 17487050 (+)
AMCG00014525 NA other upstream 9734674 16465621 ~ 16469209 (+)
AMCG00014508 NA other upstream 10064851 16129479 ~ 16139032 (+)
AMCG00014687 NA other downstream 660419 26904877 ~ 26911237 (+)
AMCG00014704 fundc1,LOC102219358,LOC102292135,LOC102776203,LOC103475814,LOC106926458 other downstream 1591045 27835503 ~ 27841871 (+)
AMCG00014703 ndp,LOC107565935,LOC106586792 other downstream 1624245 27868703 ~ 27879800 (+)
G72175 LOC102776245 other downstream 2057915 28302373 ~ 28304073 (+)
AMCG00014729 NA other downstream 2552591 28797049 ~ 28837910 (+)

Expression


Co-expression Network