AMCG00014678 (fgf14)


Basic Information

Item Value
gene id AMCG00014678
gene name fgf14
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030128.1
NCBI id CM030128.1
chromosome length 42883965
location 26643240 ~ 26645932 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00014678
GAACTCTTTACACCGGAATGTAAGTTTAAAGAGTCGGTATTTGAAAACTATTATGTGATCTACTCTTCCATGCTATATAGACAACAGGAGTCTGGCAGAGCTTGGTTCCTTGGTCTTAATAAGGAAGGCCAAGTCATGAAGGGGAACCGTGTGAAAAAGACAAAGCCAGCTGCTCATTTCCTGCCTAAGCCATTAGAAGTTGCCATGTATAGAGAGCCATCATTGCATGACGTTGGAGAAACTGTTCCAAAGACGGGCGTGACTCCAAGTAAAAGCACAAGTGCGTCTGCGGTGATGAACGGCGGCAAACCAGTCAGCAAGACGAGCAAGACGACATAG

Function

symbol description
fgf14 Predicted to enable sodium channel regulator activity. Predicted to be involved in regulation of voltage-gated sodium channel activity. Predicted to act upstream of or within nervous system development. Predicted to be located in extracellular region. Predicted to be active in cytoplasm and nucleus. Human ortholog(s) of this gene implicated in spinocerebellar ataxia type 27. Orthologous to human FGF14 (fibroblast growth factor 14).

NR:

description
PREDICTED: fibroblast growth factor 14 isoform X2

GO:

id name namespace
GO:0007399 nervous system development biological_process
GO:0005576 extracellular region cellular_component
GO:0008083 growth factor activity molecular_function

KEGG:

id description
K23920 FGF14, FHF4; fibroblast growth factor 14

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00014678 True 339 mRNA 0.46 2 26643240 26645932

Neighbor

gene id symbol gene type direction distance location
AMCG00014672 NA coding downstream 103678 26522096 ~ 26539562 (-)
AMCG00014674 LOC102787851 coding downstream 162962 26428681 ~ 26480278 (-)
AMCG00014673 nalcn coding downstream 214711 26404082 ~ 26428529 (-)
AMCG00014671 tmtc4,LOC107600375 coding downstream 282249 26346500 ~ 26360991 (-)
AMCG00014675 NA coding downstream 306261 26336175 ~ 26336979 (-)
AMCG00014679 fgf14 coding upstream 35248 26681180 ~ 26698625 (-)
AMCG00014686 NA coding upstream 256289 26902221 ~ 26904187 (-)
AMCG00014688 NA coding upstream 334189 26980121 ~ 27034019 (-)
AMCG00014689 shox,LOC102229599 coding upstream 533171 27179103 ~ 27189518 (-)
AMCG00014700 NA coding upstream 727140 27373072 ~ 27377772 (-)
G71882 NA non-coding downstream 308240 26334655 ~ 26335000 (-)
G71880 NA non-coding downstream 318986 26324038 ~ 26324254 (-)
G71879 NA non-coding downstream 361275 26281374 ~ 26281965 (-)
G71876 NA non-coding downstream 374833 26267867 ~ 26268407 (-)
G71875 NA non-coding downstream 377024 26265731 ~ 26266216 (-)
G71961 NA non-coding upstream 286336 26932268 ~ 26932637 (-)
G72049 NA non-coding upstream 772884 27418816 ~ 27419045 (-)
G72089 NA non-coding upstream 884364 27530296 ~ 27530643 (-)
G72139 NA non-coding upstream 1190407 27836339 ~ 27837927 (-)
G72146 NA non-coding upstream 1210807 27856739 ~ 27861375 (-)
AMCG00014630 LOC107672672 other downstream 4398325 22225924 ~ 22244915 (-)
AMCG00014603 tpt1,LOC106582181 other downstream 7418010 19217722 ~ 19225230 (-)
AMCG00014604 kctd4,LOC107688678,LOC107748885 other downstream 7439673 19201803 ~ 19203567 (-)
AMCG00014567 mzt1,si:dkey-15d12.2 other downstream 8621145 17990651 ~ 18022095 (-)
AMCG00014559 NA other downstream 9022089 17589267 ~ 17621151 (-)
AMCG00014693 NA other upstream 639488 27285420 ~ 27304597 (-)
AMCG00014692 LOC107756725 other upstream 689763 27335695 ~ 27369527 (-)
G72236 rpl8,LOC107595836,LOC107748161 other upstream 1683807 28329739 ~ 28332482 (-)
G72477 LOC106598269,LOC101158751,LOC106586690,LOC103361283 other upstream 2743358 29389290 ~ 29398305 (-)
AMCG00014775 NA other upstream 4195591 30841523 ~ 30846800 (-)

Expression


Co-expression Network