AMCG00014727 (gsk3b,LOC107703010)


Basic Information

Item Value
gene id AMCG00014727
gene name gsk3b,LOC107703010
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030128.1
NCBI id CM030128.1
chromosome length 42883965
location 28881917 ~ 28890968 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00014727
GACAAAGATGGCAGCAAGGTGACCACAGTGGTGGCAACCCCGGGCCAGGGTCCCGACCGACCGCAGGAGGTCAGCTACACCGACACCAAGGTCATCGGCAATGGATCCTTTGGGGTGGTCTACCAAGCTAAGCTCTGTGACTCCGGGGAGCTGGTCGCCATCAAGAAGGTCCTACAGGACAAGAGGTTCAAGAACCGAGAGCTTCAGATCATGAGGAAACTGGATCACTGCAACATTGTCCGATTGCGCTACTTCTTTTACTCCAGCGGGGAG

Function

symbol description
gsk3b Enables several functions, including NF-kappaB binding activity; enzyme binding activity; and protein kinase activity. Involved in several processes, including pallium development; protein phosphorylation; and regulation of neuron death. Acts upstream of or within several processes, including ER overload response; peptidyl-serine phosphorylation; and positive regulation of protein export from nucleus. Located in several cellular components, including centrosome; nucleoplasm; and plasma membrane. Part of beta-catenin destruction complex. Is active in glutamatergic synapse. Implicated in Alzheimer's disease; amyotrophic lateral sclerosis; bipolar disorder; and schizophrenia. Biomarker of colorectal adenocarcinoma; degenerative disc disease; endometrial carcinoma; and schizophrenia.

NR:

description
PREDICTED: glycogen synthase kinase-3 beta-like

GO:

id name namespace
GO:0003146 heart jogging biological_process
GO:0006468 protein phosphorylation biological_process
GO:0001947 heart looping biological_process
GO:0005524 ATP binding molecular_function
GO:0004674 protein serine/threonine kinase activity molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00014727 True 273 mRNA 0.56 2 28881917 28890968

Neighbor

gene id symbol gene type direction distance location
AMCG00014725 lrrc58,LOC106574305 coding upstream 102627 28767435 ~ 28779290 (+)
AMCG00014726 LOC103028151 coding upstream 115827 28695811 ~ 28766090 (+)
AMCG00014723 NA coding upstream 272730 28591078 ~ 28609187 (+)
AMCG00014724 NA coding upstream 290957 28583469 ~ 28590960 (+)
AMCG00014720 NA coding upstream 398067 28456195 ~ 28483850 (+)
AMCG00014728 gsk3b,LOC107559500,LOC107721573,LOC107551994,LOC107715908 coding downstream 14933 28905901 ~ 28916634 (+)
AMCG00014734 NA coding downstream 205161 29096129 ~ 29110638 (+)
AMCG00014733 NA coding downstream 229983 29120951 ~ 29129042 (+)
AMCG00014737 NA coding downstream 416972 29307940 ~ 29321592 (+)
AMCG00014741 LOC106586690,LOC106582147,LOC106575755 coding downstream 492520 29383488 ~ 29398221 (+)
G72329 NA non-coding upstream 49942 28831756 ~ 28831975 (+)
G72273 NA non-coding upstream 303184 28526788 ~ 28578733 (+)
G72208 NA non-coding upstream 540200 28337291 ~ 28341717 (+)
G72173 NA non-coding upstream 581104 28297669 ~ 28300813 (+)
G72169 NA non-coding upstream 584433 28240566 ~ 28297484 (+)
G72341 NA non-coding downstream 28008 28918976 ~ 28921290 (+)
G72353 NA non-coding downstream 90154 28981122 ~ 28985576 (+)
G72354 NA non-coding downstream 98639 28989607 ~ 28991299 (+)
G72409 NA non-coding downstream 246161 29137129 ~ 29137353 (+)
G72415 NA non-coding downstream 266057 29157025 ~ 29160425 (+)
AMCG00014729 NA other upstream 44007 28797049 ~ 28837910 (+)
G72175 LOC102776245 other upstream 577844 28302373 ~ 28304073 (+)
AMCG00014703 ndp,LOC107565935,LOC106586792 other upstream 1002117 27868703 ~ 27879800 (+)
AMCG00014704 fundc1,LOC102219358,LOC102292135,LOC102776203,LOC103475814,LOC106926458 other upstream 1040046 27835503 ~ 27841871 (+)
AMCG00014687 NA other upstream 1970680 26904877 ~ 26911237 (+)
AMCG00014739 NA other downstream 356907 29247875 ~ 29256354 (+)
AMCG00014738 NA other downstream 377361 29268329 ~ 29279149 (+)
AMCG00014757 LOC105927538,LOC107688735,LOC105016589,LOC104946938,LOC107716767,LOC107676512,LOC107099897,LOC103140352 other downstream 952499 29843467 ~ 29846586 (+)
G72605 NA other downstream 960482 29851450 ~ 29851821 (+)
AMCG00014777 NA other downstream 1873383 30764351 ~ 30812287 (+)

Expression


Co-expression Network