AMCG00014769 (stxbp5l)


Basic Information

Item Value
gene id AMCG00014769
gene name stxbp5l
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030128.1
NCBI id CM030128.1
chromosome length 42883965
location 30525993 ~ 30531499 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00014769
GCCATTCACTCCGTCAGCTGGCATCACGAAGGAAAACAGTTCATGTGCAGCCATTCAGATGGTAGTCTGACGATGTGGAATATGAAGAACACAGCCAAACCCTTCCAAATCACATTCCCACATGGGAAGAACCAGCGAGACGGGAAGAAACCAGAACCTTGCAAACCGATCCTGAAGGTGGAGTACAAAACATGCAAAAGCAGTGAGCCATTTATAATCTTCTCTGGAGGGCTGTCGTATGACAAAGCTTGTCGAAGACCCAGCCTGACAATCATGCATGGCAAATCCATCACAGTGTTGGAGATGGATCATCCCATAGTGGAATTCCTAACACTTTGTGAGACTCCCTATCCTAAT

Function

symbol description
stxbp5l Predicted to act upstream of or within exocytosis and protein transport. Predicted to be located in cytoplasm and plasma membrane. Orthologous to human STXBP5L (syntaxin binding protein 5L).

NR:

description
PREDICTED: syntaxin-binding protein 5-like isoform X10

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00014769 True 357 mRNA 0.47 3 30525993 30531499

Neighbor

gene id symbol gene type direction distance location
AMCG00014767 NA coding upstream 275727 30241706 ~ 30250266 (+)
AMCG00014776 NA coding upstream 314162 30197763 ~ 30211831 (+)
AMCG00014773 NA coding upstream 343596 30175067 ~ 30182397 (+)
AMCG00014778 NA coding upstream 353987 30161978 ~ 30172006 (+)
AMCG00014760 NA coding upstream 383039 30099986 ~ 30142954 (+)
AMCG00014770 NA coding downstream 13714 30545213 ~ 30548522 (+)
AMCG00014772 NA coding downstream 62630 30594129 ~ 30610104 (+)
AMCG00014779 NA coding downstream 128102 30659601 ~ 30660595 (+)
AMCG00014774 NA coding downstream 168707 30700206 ~ 30710420 (+)
AMCG00014768 NA coding downstream 196864 30728363 ~ 30741144 (+)
G72426 NA non-coding upstream 1333715 29191971 ~ 29192278 (+)
G72415 NA non-coding upstream 1365568 29157025 ~ 29160425 (+)
G72409 NA non-coding upstream 1388640 29137129 ~ 29137353 (+)
G72354 NA non-coding upstream 1534694 28989607 ~ 28991299 (+)
G72353 NA non-coding upstream 1540417 28981122 ~ 28985576 (+)
G72767 NA non-coding downstream 305337 30836836 ~ 30837169 (+)
G72768 NA non-coding downstream 310061 30841560 ~ 30844670 (+)
G72769 NA non-coding downstream 314663 30846162 ~ 30846421 (+)
G72783 NA non-coding downstream 424406 30955905 ~ 30956284 (+)
G72789 NA non-coding downstream 471873 31003372 ~ 31003788 (+)
G72605 NA other upstream 674172 29851450 ~ 29851821 (+)
AMCG00014757 LOC105927538,LOC107688735,LOC105016589,LOC104946938,LOC107716767,LOC107676512,LOC107099897,LOC103140352 other upstream 679407 29843467 ~ 29846586 (+)
AMCG00014738 NA other upstream 1246844 29268329 ~ 29279149 (+)
AMCG00014739 NA other upstream 1269639 29247875 ~ 29256354 (+)
AMCG00014729 NA other upstream 1688083 28797049 ~ 28837910 (+)
AMCG00014777 NA other downstream 232852 30764351 ~ 30812287 (+)
G72785 fam160a2 other downstream 446717 30978216 ~ 30978825 (+)
G72786 NA other downstream 448071 30979570 ~ 30980252 (+)
G72787 NA other downstream 458564 30990063 ~ 30996363 (+)
AMCG00014786 nhlh2,LOC106574539,LOC107739819,LOC105019883 other downstream 611924 31143423 ~ 31147877 (+)

Expression


Co-expression Network