G68773 (glrx,LOC100698576,LOC103359009,LOC108424411,LOC103461279)


Basic Information

Item Value
gene id G68773
gene name glrx,LOC100698576,LOC103359009,LOC108424411,LOC103461279
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030128.1
NCBI id CM030128.1
chromosome length 42883965
location 7053931 ~ 7054306 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU85949
CACAGGGAAACCATGACCAAAACTCTTGGGAAAACTAAAACACCTACATGAGAGAAGGTATATATTTTGGCTCTGACTTGGTTGGCAAGAATAAACACATTCAGGACTGCGTCAAACTATTTCCATCATCACGTCAGCGTGTATCGGCAGGACATACCTTGGCTGTGTAGGTCTTAATGGGGGGGCAGCCCTTTGCTCCGCAGTTCAAGGCAAAGTGAACGAGAGGCTCTGCGTTGGGGAGGGCGACCTGGAGACGCGGGTCACTCTTGGAGAAGGGCTTCATCAGCTGCGCCACGCCCTTCCTGTTGCCCCGCAGCACCCCGTTCTCGATGTCCTGCAGGGTGAACACGGCGCCGCCGATCAGGTAGCTCACGTA

Function

symbol description
glrx Predicted to enable electron transfer activity; protein-disulfide reductase activity; and transferase activity. Orthologous to human GLRX (glutaredoxin).

NR:

description
PREDICTED: uncharacterized protein LOC100698576 isoform X5

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU85949 True 376 lncRNA 0.54 1 7053931 7054306

Neighbor

gene id symbol gene type direction distance location
AMCG00014263 NA coding downstream 11215 7040731 ~ 7042716 (-)
AMCG00014258 epha3 coding downstream 165841 6887026 ~ 6888090 (-)
AMCG00014257 epha3,LOC107549902,LOC107676997 coding downstream 193389 6814181 ~ 6860542 (-)
AMCG00014256 NA coding downstream 298298 6752859 ~ 6755633 (-)
AMCG00014254 arl13b coding downstream 314664 6718319 ~ 6739267 (-)
AMCG00014264 NA coding upstream 7415 7061721 ~ 7061978 (-)
AMCG00014262 NA coding upstream 7756 7062062 ~ 7070724 (-)
AMCG00014265 NA coding upstream 22733 7077039 ~ 7093313 (-)
AMCG00014268 chmp2b,LOC108435168 coding upstream 185978 7240284 ~ 7254356 (-)
AMCG00014269 LOC108441420,LOC107582737,LOC107726519,LOC106592197 coding upstream 293146 7347452 ~ 7365740 (-)
G68767 NA non-coding downstream 8119 7044125 ~ 7045812 (-)
G68757 NA non-coding downstream 63064 6990603 ~ 6990867 (-)
G68724 NA non-coding downstream 373643 6680025 ~ 6680288 (-)
G68722 NA non-coding downstream 519230 6534480 ~ 6534701 (-)
G68680 edar,LOC107697794,LOC107757718 non-coding downstream 997600 6054111 ~ 6056331 (-)
G68774 NA non-coding upstream 471 7054777 ~ 7058319 (-)
G68826 NA non-coding upstream 233757 7288063 ~ 7288335 (-)
G68827 NA non-coding upstream 234630 7288936 ~ 7289437 (-)
G68829 NA non-coding upstream 286045 7340351 ~ 7340555 (-)
G68867 NA non-coding upstream 386194 7440500 ~ 7441172 (-)
AMCG00014241 NA other downstream 945573 6059489 ~ 6108358 (-)
AMCG00014228 NA other downstream 1375432 5659072 ~ 5678499 (-)
AMCG00014181 ppef1,LOC105893339,LOC108425737,LOC107695075 other downstream 3659177 3385757 ~ 3394754 (-)
G68088 NA other downstream 4224787 2825562 ~ 2829144 (-)
AMCG00014144 NA other downstream 4400684 2641059 ~ 2653247 (-)
AMCG00014271 NA other upstream 323782 7378088 ~ 7386984 (-)
AMCG00014276 LOC106575771,LOC106574874,LOC107705522,LOC107584803,LOC105911816,LOC105019730 other upstream 347846 7402152 ~ 7411890 (-)
AMCG00014278 NA other upstream 359423 7413729 ~ 7423291 (-)
AMCG00014297 NA other upstream 1080597 8134903 ~ 8139126 (-)
AMCG00014298 NA other upstream 1101626 8155932 ~ 8158590 (-)

Expression


Co-expression Network