AMCG00020643 (si:dkey-246g23.2,LOC107684666,LOC107749300,LOC107553994,LOC107670153,LOC107738383)


Basic Information

Item Value
gene id AMCG00020643
gene name si:dkey-246g23.2,LOC107684666,LOC107749300,LOC107553994,LOC107670153,LOC107738383
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030127.1
NCBI id CM030127.1
chromosome length 42978078
location 27406955 ~ 27408112 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00020643
ATGGATATGGAAGTGGACCTAGGCGTGGATATTGAGGGGGACCCCGAGGGATCCTGGTCTCTGCTGTCATGGCTGGCATCCTGTGTCATGGTCTTCGGGGGGGTGGTGCCCTACATCCCCCAGTACCAGGAGATCCAGAGGACCTCCAACACTGAGGGCTTCTCCACCCGCGTCTGCCTTGTCCTGCTGGTGGCCAACATTCTCAGAGTCTTTTTCTGGATTGGGAAGCAGTTTGAGCTGACTCTCCTGCTGCAGAGTCTGGTGATGATCGGCACCATGCTGGCCATGCTCAACTTGTGCTGTACAGTCCAGACCAGCAACCGAGTCTCCACCAAGCAACACCATTTCACAGGTACACGTCCCTTCATTGCACTCTCATGGAAAGTCACGTCATAA

Function

symbol description
si:dkey-246g23.2 Predicted to be involved in phospholipid translocation and retrograde transport, endosome to Golgi. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be active in endosome and trans-Golgi network. Orthologous to human SLC66A2 (solute carrier family 66 member 2).

NR:

description
PREDICTED: PQ-loop repeat-containing protein 1-like

GO: NA

KEGG:

id description
K23679 PQLC1, SLC66A2; solute carrier family 66, member 2

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00020643 True 396 mRNA 0.55 2 27406955 27408112

Neighbor

gene id symbol gene type direction distance location
AMCG00020644 NA coding downstream 120883 27281615 ~ 27286072 (-)
AMCG00020647 NA coding downstream 137512 27259852 ~ 27269443 (-)
AMCG00020635 NA coding downstream 298675 27102401 ~ 27108280 (-)
AMCG00020627 NA coding downstream 964502 26415975 ~ 26442453 (-)
AMCG00020628 NA coding downstream 1013904 26372786 ~ 26393051 (-)
AMCG00020645 zgc:173742,LOC107684664,LOC107749320,LOC107553995,LOC108415671 coding upstream 12936 27421048 ~ 27425477 (-)
AMCG00020646 zgc:173742,LOC108415671,LOC107553995,LOC107684664,LOC107749320,LOC108264272 coding upstream 27557 27435669 ~ 27474732 (-)
AMCG00020649 NA coding upstream 114512 27522624 ~ 27523548 (-)
AMCG00020650 NA coding upstream 191102 27599214 ~ 27711704 (-)
AMCG00020651 NA coding upstream 344082 27752194 ~ 27786025 (-)
G64708 NA non-coding downstream 170633 27236083 ~ 27236322 (-)
G64632 NA non-coding downstream 661132 26745549 ~ 26745823 (-)
G64630 NA non-coding downstream 674667 26731435 ~ 26732288 (-)
G64629 NA non-coding downstream 676844 26729855 ~ 26730111 (-)
G64627 NA non-coding downstream 771167 26635588 ~ 26635788 (-)
G64745 NA non-coding upstream 12254 27420366 ~ 27420646 (-)
G64847 NA non-coding upstream 908657 28316769 ~ 28323164 (-)
G64886 NA non-coding upstream 1449877 28857989 ~ 28858354 (-)
G64912 NA non-coding upstream 1588280 28996392 ~ 29001633 (-)
G64991 LOC103376870 non-coding upstream 1851445 29259557 ~ 29314059 (-)
AMCG00020639 LOC107583916 other downstream 157279 27246014 ~ 27249676 (-)
AMCG00020613 NA other downstream 1458612 25934901 ~ 25948343 (-)
G64470 NA other downstream 1488325 25898428 ~ 25918630 (-)
AMCG00020614 NA other downstream 1501357 25886050 ~ 25905598 (-)
AMCG00020604 NA other downstream 1691498 25687275 ~ 25715457 (-)
AMCG00020657 NA other upstream 753490 28161602 ~ 28239074 (-)
G64811 NA other upstream 818423 28226535 ~ 28229647 (-)
AMCG00020661 ss18l2 other upstream 916925 28325037 ~ 28328312 (-)
G64882 NA other upstream 1380468 28788580 ~ 28796956 (-)
G65000 NA other upstream 1973203 29381315 ~ 29405636 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
grasscarp (Ctenopharyngodon idella) CI01000013_07293239_07332640 PQLC1 coding CI01000013 null 7292985 ~ 7332660 (-)