G59717 (tbc1d13,LOC102788004,LOC106562828)


Basic Information

Item Value
gene id G59717
gene name tbc1d13,LOC102788004,LOC106562828
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030127.1
NCBI id CM030127.1
chromosome length 42978078
location 3117522 ~ 3117909 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU74673
TGTGCAAGGAGTTGGGGCTGGGATGCTGTAGGGGTTCTGTGAAGAGTCTCGGCTGTGAGAGGTGAAGACGGGAGGGTACAGGTTTCTGCACTTACCCTTCCACTCACTGTTGGGGTCGGAGGCGAAGGTGTAGTAAATGGGCCCCACGATCTCGTTCATGCCCTGCACGTAGGCGATGCCCGGGTTCAGCTTGGCGTAGATGAACAGGATGCGCTCCACCACCTCCCAGTGCGCCTCGCAGCCGTTGGGCAGCACCTCATACTCGTTGGAGGGGTACAGATTCTGCGACTTCCCCGGGGAGCCCACCTGTGCCAGAGGACACCACCCACATCAGTGCCCTGCTCACACACGGACCGGCAACACCGACCGAGCCGCCCTCCTCATCACA

Function

symbol description
tbc1d13 Orthologous to human TBC1D13 (TBC1 domain family member 13).

NR:

description
PREDICTED: TBC1 domain family member 13 isoform X1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU74673 True 388 lncRNA 0.61 1 3117522 3117909

Neighbor

gene id symbol gene type direction distance location
AMCG00019924 NA coding upstream 86047 3024389 ~ 3031475 (+)
AMCG00019925 NA coding upstream 96745 3016234 ~ 3020777 (+)
AMCG00019926 NA coding upstream 112617 2995864 ~ 3004905 (+)
AMCG00019921 NA coding upstream 198641 2910244 ~ 2918881 (+)
AMCG00019915 barhl1b,LOC107708351,LOC107595696,LOC105902520,LOC107556939,LOC100712077 coding upstream 240704 2869705 ~ 2876818 (+)
AMCG00019930 LOC107573633,LOC104949698,LOC107679461,LOC108251755 coding downstream 12020 3129929 ~ 3141283 (+)
AMCG00019929 LOC103370734,LOC104955211 coding downstream 24538 3142447 ~ 3147034 (+)
AMCG00019932 NA coding downstream 31185 3149094 ~ 3157541 (+)
AMCG00019931 endog coding downstream 40688 3158597 ~ 3161191 (+)
AMCG00019935 NA coding downstream 75878 3193787 ~ 3196215 (+)
G59716 NA non-coding upstream 70 3117214 ~ 3117452 (+)
G59715 NA non-coding upstream 703 3116518 ~ 3116819 (+)
G59714 NA non-coding upstream 7640 3107800 ~ 3109882 (+)
G59700 NA non-coding upstream 83181 3031878 ~ 3034341 (+)
G59646 NA non-coding upstream 232106 2883714 ~ 2885416 (+)
G59718 NA non-coding downstream 1903 3119812 ~ 3120189 (+)
G59746 NA non-coding downstream 81713 3199622 ~ 3200478 (+)
G59800 NA non-coding downstream 361871 3479780 ~ 3480109 (+)
G59821 NA non-coding downstream 530420 3648329 ~ 3651107 (+)
G59835 NA non-coding downstream 570891 3688800 ~ 3689000 (+)
AMCG00019920 NA other upstream 147927 2962508 ~ 2969595 (+)
AMCG00019884 NA other upstream 2008526 1074816 ~ 1108996 (+)
G59305 NA other upstream 2671992 441598 ~ 445530 (+)
AMCG00019934 NA other downstream 123399 3241308 ~ 3251407 (+)
AMCG00019967 prrc2b other downstream 1705904 4823813 ~ 4856929 (+)
G60137 NA other downstream 2237863 5355772 ~ 5361863 (+)
G60132 NA other downstream 2240555 5358464 ~ 5359365 (+)
AMCG00020001 NA other downstream 2989085 6106994 ~ 6114196 (+)

Expression


Co-expression Network