G65068 (cdyl2,LOC106562298)



Basic Information


Item Value
gene id G65068
gene name cdyl2,LOC106562298
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030127.1
NCBI id CM030127.1
chromosome length 42978078
location 30672745 ~ 30672962 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>TU81379
CTCGGGGGTTAGTGCATTGTTGTCAGATGTTTGGCTTGATAGCAGTATGTGTGTGAAACCGTCTTCTTTCCTAACCACAATGTCCCTGAATCGACAGTTGCTTTCATTCTGCCGAACGTTGTATCTGAGTCTCTTGTCAAACACATAGCCTTTCTCTTCCACCAGTTTCCGTTTCATTGAACTGTGCAAATTAATTCCACCATTAGAAAGTGTGGACC

Function


symbol description
cdyl2 Predicted to enable transcription corepressor activity. Predicted to be involved in negative regulation of transcription, DNA-templated. Predicted to be active in nucleus.

NR:

description
PREDICTED: chromodomain Y-like protein 2

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU81379 True 218 lncRNA 0.44 1 30672745 30672962

Neighbor


gene id symbol gene type direction distance location
AMCG00020693 NA coding downstream 252111 30365020 ~ 30420634 (-)
AMCG00020692 NA coding downstream 527218 30128219 ~ 30145527 (-)
AMCG00020686 NA coding downstream 1168333 29487288 ~ 29504412 (-)
AMCG00020680 NA coding downstream 1204724 29464875 ~ 29468021 (-)
AMCG00020682 NA coding downstream 1215094 29418816 ~ 29457651 (-)
AMCG00020699 NA coding upstream 85164 30758126 ~ 30760083 (-)
AMCG00020706 NA coding upstream 466731 31139693 ~ 31143403 (-)
AMCG00020705 NA coding upstream 473125 31146087 ~ 31151972 (-)
AMCG00020711 NA coding upstream 753559 31426521 ~ 31432953 (-)
AMCG00020712 NA coding upstream 762666 31435628 ~ 31448649 (-)
G65061 NA non-coding downstream 55611 30616880 ~ 30617134 (-)
G65050 NA non-coding downstream 136849 30535292 ~ 30535896 (-)
G65035 wwox,LOC107555694,LOC107742620,LOC107669551 non-coding downstream 281877 30126689 ~ 30390868 (-)
G65033 NA non-coding downstream 689380 29983113 ~ 29983365 (-)
G65023 NA non-coding downstream 786846 29885601 ~ 29885899 (-)
G65071 NA non-coding upstream 20186 30693148 ~ 30693367 (-)
G65073 NA non-coding upstream 27524 30700486 ~ 30702173 (-)
G65109 NA non-coding upstream 157219 30830181 ~ 30830542 (-)
G65166 NA non-coding upstream 479457 31152419 ~ 31156265 (-)
G65178 NA non-coding upstream 539976 31212938 ~ 31217885 (-)
AMCG00020694 wwox other downstream 141609 30449745 ~ 30531136 (-)
AMCG00020685 bat1,slc7a9,LOC106592435,LOC102305828,LOC106596152 other downstream 1139628 29520191 ~ 29533117 (-)
G65000 NA other downstream 1267109 29381315 ~ 29405636 (-)
G64882 NA other downstream 1875789 28788580 ~ 28796956 (-)
AMCG00020661 ss18l2 other downstream 2344433 28325037 ~ 28328312 (-)
AMCG00020700 NA other upstream 49821 30722783 ~ 30737976 (-)
AMCG00020702 NA other upstream 127620 30800582 ~ 30808846 (-)
AMCG00020713 NA other upstream 692701 31365663 ~ 31412823 (-)
AMCG00020746 NA other upstream 1448923 32121885 ~ 32122933 (-)
G65549 NA other upstream 1685276 32358238 ~ 32365142 (-)

Expression



Co-expression Network