G69228


Basic Information

Item Value
gene id G69228
gene name NA
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056707.1
NCBI id CM032076.1
chromosome length 26426558
location 10444293 ~ 10444641 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU102394
AGGGTACACAGTCCCACGGATACCAGAGGCTGGACAGTGCATGTTTTTTCCATTTAGGTACAGGTTCAGTTCCACGTGGTCATAGGTCACCCCCTTAAAACAGGAAACACTCATTTACGAACGGAAGCAAGCAGCATCTTATACAGCAAGTACTCACTGTTCAACTTCTGCCAGTAAAACCGTACCACTATGTCCCCTCCTGAGGCAGGCTATTGGCAGGTAATCGGCTCTTCTCCTCGTTGTTGTGGTGTATAGAGCCATCGTGTCGAAGCACCAAACTGTGACTGTCTCGACCCAGAGGCACCTGGTTCAAATTCACCTTCTGAGTGGCCACACCGATCCCCCAAAC

Function

GO:

id name namespace
GO:0050953 sensory perception of light stimulus biological_process
GO:0007601 visual perception biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU102394 True 349 lncRNA 0.50 1 10444293 10444641

Neighbor

gene id symbol gene type direction distance location
rnaseh2b rnaseh2b,LOC107663845,LOC107555203,LOC107720151,LOC107655484,LOC107706085,LOC107600411 coding downstream 24907 10416256 ~ 10419386 (-)
LOC122351326 LOC107706086,LOC107555206,LOC107663846,LOC107720148,LOC107655485,LOC107600435 coding downstream 32779 10408759 ~ 10411514 (-)
cmss1 cmss1 coding downstream 154778 10285026 ~ 10289515 (-)
tmem30c tmem30c,LOC107655489,LOC107706099,LOC107720155,LOC107555223,LOC107600433,LOC107663858 coding downstream 159671 10278858 ~ 10284622 (-)
col8a1a col8a1a,col8a1,LOC107720134,LOC108432575,LOC107748221 coding downstream 196801 10239297 ~ 10247492 (-)
LOC122351939 LOC107720137 coding upstream 2339 10446980 ~ 10462522 (-)
LOC122351938 LOC107720137,LOC107655483 coding upstream 2742 10447383 ~ 10454136 (-)
mcf2lb LOC107663886,LOC107555216,LOC107720127,LOC107655510,LOC569231 coding upstream 18354 10462995 ~ 10479085 (-)
rnf17 rnf17 coding upstream 43056 10487697 ~ 10504466 (-)
uggt2 uggt2,LOC107600415,LOC107720140,LOC107663813,LOC107655477,LOC108430493,LOC108266228 coding upstream 87012 10531653 ~ 10558579 (-)
G69223 NA non-coding downstream 17828 10426227 ~ 10426465 (-)
LOC122351639 NA non-coding downstream 180846 10253933 ~ 10263447 (-)
G69157 NA non-coding downstream 202081 10117793 ~ 10242212 (-)
G69168 NA non-coding downstream 305534 10136649 ~ 10138759 (-)
G69136 LOC107555234,LOC107655498,LOC107748211,LOC107663925,LOC107720146,LOC107600385 non-coding downstream 334050 10108975 ~ 10110243 (-)
G69231 NA non-coding upstream 636 10445277 ~ 10446767 (-)
G69346 NA non-coding upstream 392871 10837512 ~ 10844040 (-)
LOC122352018 NA non-coding upstream 405182 10849823 ~ 10908594 (-)
LOC122351427 NA non-coding upstream 485839 10930480 ~ 10946744 (-)
G69361 NA non-coding upstream 499798 10944439 ~ 10945055 (-)
trim13 trim13,LOC107720128,LOC107555217,LOC107663864,LOC107706093,LOC107600394,LOC107655513 other downstream 674 10433507 ~ 10443619 (-)
LOC122351483 LOC107663814,LOC107733620,LOC107555196,LOC107720141,LOC107600416,LOC107655476 other downstream 534115 9908188 ~ 9910178 (-)
als2a als2a,LOC107688763,LOC107596546,LOC107668398,LOC107752891,LOC107592992,LOC107738114 other downstream 2349446 8076468 ~ 8094847 (-)
LOC122351623 raph1,LOC107592998,LOC107668371,LOC107752894,LOC107738113,LOC107688760,LOC107738116,LOC107596536 other downstream 2419621 8014449 ~ 8024672 (-)
LOC122351350 cb064,LOC107688735,LOC107716767,LOC107676512,LOC108232354,LOC103042106,LOC105927538 other downstream 3290339 7070985 ~ 7153954 (-)
fdx1 fdx1,LOC107663820,LOC107706088,LOC107720152,LOC107655504,LOC107600437,LOC107555213,LOC107655505 other upstream 70631 10515272 ~ 10519457 (-)
mrasa LOC107551943,LOC107663912,LOC107733654,LOC107600440,LOC107738526 other upstream 235517 10680158 ~ 10686627 (-)
LOC122351858 slc10a2,LOC107663831,LOC107567642,LOC107675341,LOC107738529 other upstream 952025 11396666 ~ 11493120 (-)
LOC122351308 si:rp71-84d19.3,gtpbp8,LOC107663822,LOC107567641,LOC107738531,LOC107733632,LOC107598183 other upstream 1052306 11496947 ~ 11500495 (-)
gtdc1 gtdc1,LOC107709416,LOC107555857,LOC107563182,LOC107675364,LOC107673117 other upstream 1646490 12091131 ~ 12194961 (-)

Expression


Co-expression Network