G826


Basic Information

Item Value
gene id G826
gene name NA
gene type unknown
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056699.1
NCBI id CM032068.1
chromosome length 31761587
location 4358007 ~ 4358296 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU1199
ggacccttgccagcagttgtgctaaagttcttttatctatgaagacgttgctcctgctcgcattggcctccatcaagagggtaggggacctgcaggctttttcggtcgacgattcgtgcctacagtttgggctcgcggattcccaggtaacactgaggccacggcccggctacgtgcccaaggttcccactacccccttcagagaccaggtggtgaaccttcaagcgctgcccctggaggaggcagacccagccctgacgttgcttgtcccgtccgagcactaagatgct

Function

GO:

id name namespace
GO:0004418 hydroxymethylbilane synthase activity molecular_function

KEGG:

id description
ko00860 Porphyrin and chlorophyll metabolism

RNA

RNA id representative length rna type GC content exon number start site end site
TU1199 True 290 TUCP 0.39 1 4358007 4358296

Neighbor

gene id symbol gene type direction distance location
LOC122342374 erbb4a,LOC107674013,LOC107725343,LOC107556266,LOC108440448,LOC107557316,LOC107707608 coding upstream 125504 4221283 ~ 4232503 (+)
LOC122352357 slitrk1,LOC107756981,LOC107570247,LOC107744763,LOC107556534 coding upstream 346637 4007775 ~ 4011370 (+)
slitrk6 slitrk6,LOC107674010,LOC107558904,LOC107730399,LOC107574216,LOC107737039,LOC107698122 coding upstream 540011 3804599 ~ 3817996 (+)
LOC122350229 gpc6a,LOC107730398,LOC107744956,LOC107553997,LOC105911916,LOC108414264,LOC100710496 coding upstream 1237187 2941770 ~ 3120820 (+)
LOC122328837 gpc6a,LOC107730398,LOC107744956,LOC107553997,LOC105911916,LOC103365236 coding upstream 1575823 2758083 ~ 2782184 (+)
spry2 spry2,LOC107549433,LOC107750630,LOC107674014,LOC107676062,LOC107750049,LOC107556294 coding downstream 136898 4495194 ~ 4499239 (+)
tuba8l2 tuba8l2,LOC107750365,LOC107556293,LOC103042625,LOC108411703,LOC107549435 coding downstream 190156 4548452 ~ 4554686 (+)
stk16 stk16,LOC107674016,LOC107750290,LOC107676064 coding downstream 197209 4555505 ~ 4561710 (+)
atic atic,LOC107556291,LOC107750210,LOC107674004,LOC107549437,LOC107750055,LOC107676052 coding downstream 231735 4590031 ~ 4597077 (+)
LOC122346000 cpo,LOC107556274,LOC108440461,LOC108258336 coding downstream 286638 4644934 ~ 4649367 (+)
G815 NA non-coding upstream 58809 4294053 ~ 4299198 (+)
LOC122346159 LOC107557315,LOC107705456,LOC107725343,LOC107707608,LOC107674013,LOC107667809,LOC107556266 non-coding upstream 136719 4219242 ~ 4221288 (+)
LOC122346127 erbb4,LOC107741926,LOC107660610,LOC107721020,LOC107662043,LOC107555909 non-coding upstream 139407 4209409 ~ 4218600 (+)
LOC122341420 NA non-coding upstream 333669 4020097 ~ 4024338 (+)
G771 NA non-coding upstream 637468 3720264 ~ 3720539 (+)
G856 NA non-coding downstream 143945 4502241 ~ 4502477 (+)
G857 NA non-coding downstream 145236 4503532 ~ 4503821 (+)
G852 NA non-coding downstream 182694 4540990 ~ 4542948 (+)
G843 NA non-coding downstream 217848 4576144 ~ 4599814 (+)
G847 LOC107749885,LOC107750053,LOC107676051 non-coding downstream 250235 4608531 ~ 4609874 (+)
G824 NA other upstream 747 4356698 ~ 4357260 (+)
G749 LOC107730401,LOC107558902,LOC107677853,LOC107698126,LOC107561275,LOC107737038,LOC108411062 other upstream 658914 3636707 ~ 3699093 (+)
G727 NA other upstream 1017131 3334658 ~ 3340876 (+)
G482 dusp27 other upstream 1761705 2594931 ~ 2596302 (+)
G474 f10,LOC107654567,LOC107694470,LOC107751061,LOC107747060 other upstream 1830763 2524525 ~ 2527244 (+)
prkag3a prkag3a,LOC107750059,LOC107673997,LOC107676055 other downstream 579885 4938181 ~ 4944841 (+)
gtf3c3 gtf3c3,LOC107706835,LOC107750061 other downstream 608890 4967186 ~ 4977263 (+)
hecw2b hecw2,LOC107674007,LOC107676038,LOC108258347,LOC107706834 other downstream 620829 4979125 ~ 5025914 (+)
G1168 LOC107725347,LOC107565259,LOC107701771 other downstream 1521164 5879460 ~ 5881134 (+)
G1183 actb,actb1,LOC102799139,LOC107581721,LOC103039558 other downstream 1699108 6057404 ~ 6087655 (+)

Expression


Co-expression Network