G869


Basic Information

Item Value
gene id G869
gene name NA
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056699.1
NCBI id CM032068.1
chromosome length 31761587
location 4613572 ~ 4614130 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU1244
GATGGCATCACATCTCCAGCGACCTCGGCCTTGGCCAAAGCATGTGCAGTTCATCATGTAGCCCTGGTCATGACGTTTATCGAAGGTCTCGTTAACATCATATGTTTGTCCATTCACGACACACTGGTCTGAGCTGAGTGTGGGAAATGCAGTTCCACTCTCCGCGTCCGTTGCCCTGGCACGTGCAGCGCATCATGTGACCAAGCGTGTCGTGCCGTTTGTCCCACTCGTCGCCCACACGGTACATGACATCATTAATGGTGCAGACTTCCTCATGAGC

Function

GO: NA

KEGG:

id description
ko04610 Complement and coagulation cascades

RNA

RNA id representative length rna type GC content exon number start site end site
TU1244 True 280 lncRNA 0.44 2 4613572 4614130

Neighbor

gene id symbol gene type direction distance location
atic atic,LOC107556291,LOC107750210,LOC107674004,LOC107549437,LOC107750055,LOC107676052 coding upstream 16495 4590031 ~ 4597077 (+)
stk16 stk16,LOC107674016,LOC107750290,LOC107676064 coding upstream 51862 4555505 ~ 4561710 (+)
tuba8l2 tuba8l2,LOC107750365,LOC107556293,LOC103042625,LOC108411703,LOC107549435 coding upstream 58886 4548452 ~ 4554686 (+)
spry2 spry2,LOC107549433,LOC107750630,LOC107674014,LOC107676062,LOC107750049,LOC107556294 coding upstream 114333 4495194 ~ 4499239 (+)
LOC122342374 erbb4a,LOC107674013,LOC107725343,LOC107556266,LOC108440448,LOC107557316,LOC107707608 coding upstream 381069 4221283 ~ 4232503 (+)
LOC122346000 cpo,LOC107556274,LOC108440461,LOC108258336 coding downstream 30804 4644934 ~ 4649367 (+)
LOC122346016 cpo,LOC107556274,LOC108440461 coding downstream 38502 4652632 ~ 4657892 (+)
LOC122346006 cpo,LOC107556274,LOC108440461 coding downstream 45740 4659870 ~ 4664510 (+)
abcb6a abcb6,abcb6a,LOC107676041,LOC106574324 coding downstream 308397 4922527 ~ 4931978 (+)
cnppd1 cnppd1,LOC107706838,LOC107676054,LOC107750058,LOC107549439,LOC107556284 coding downstream 318325 4932455 ~ 4937679 (+)
G847 LOC107749885,LOC107750053,LOC107676051 non-coding upstream 3698 4608531 ~ 4609874 (+)
G843 NA non-coding upstream 13758 4576144 ~ 4599814 (+)
G852 NA non-coding upstream 70624 4540990 ~ 4542948 (+)
G857 NA non-coding upstream 109751 4503532 ~ 4503821 (+)
G856 NA non-coding upstream 111095 4502241 ~ 4502477 (+)
G870 NA non-coding downstream 688 4614818 ~ 4615402 (+)
G872 NA non-coding downstream 1988 4616118 ~ 4616939 (+)
G853 NA non-coding downstream 5113 4619243 ~ 4619729 (+)
LOC122346166 NA non-coding downstream 9917 4624047 ~ 4627918 (+)
LOC122346140 NA non-coding downstream 282374 4896504 ~ 4918795 (+)
G826 NA other upstream 255276 4358007 ~ 4358296 (+)
G824 NA other upstream 256312 4356698 ~ 4357260 (+)
G749 LOC107730401,LOC107558902,LOC107677853,LOC107698126,LOC107561275,LOC107737038,LOC108411062 other upstream 914479 3636707 ~ 3699093 (+)
G727 NA other upstream 1272696 3334658 ~ 3340876 (+)
G482 dusp27 other upstream 2017270 2594931 ~ 2596302 (+)
prkag3a prkag3a,LOC107750059,LOC107673997,LOC107676055 other downstream 324051 4938181 ~ 4944841 (+)
gtf3c3 gtf3c3,LOC107706835,LOC107750061 other downstream 353056 4967186 ~ 4977263 (+)
hecw2b hecw2,LOC107674007,LOC107676038,LOC108258347,LOC107706834 other downstream 364995 4979125 ~ 5025914 (+)
G1168 LOC107725347,LOC107565259,LOC107701771 other downstream 1265330 5879460 ~ 5881134 (+)
G1183 actb,actb1,LOC102799139,LOC107581721,LOC103039558 other downstream 1443274 6057404 ~ 6087655 (+)

Expression


Co-expression Network