LOC122342374 (erbb4a,LOC107674013,LOC107725343,LOC107556266,LOC108440448,LOC107557316,LOC107707608)


Basic Information

Item Value
gene id LOC122342374
gene name erbb4a,LOC107674013,LOC107725343,LOC107556266,LOC108440448,LOC107557316,LOC107707608
gene type coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056699.1
NCBI id CM032068.1
chromosome length 31761587
location 4221283 ~ 4232503 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>XM_043236152.1
CTTCAGATGGCTCAAACTGTAGATTCCAGCAACATTGAGAAGTTTGTCAATTGCACCAAAATCAACGGCAACCTCATCTTCCTCATCACAGGCATTAAAGGGGACATGTTTCATGGCATAAAAGCTCTGGACCCTGATCGGTTAAATGTATTCCGCACCGTCAGAGAGATCACAGGTTTCTTGAACATTCAGTCTTGGCCGGAAAACATGACAGATCTTGGCGTTTTCTCAAACCTTGCCACCATCGGAGGACGCTCTCTGTATAGAGGCACAGTCACGCCTCGTTTGATTCCCGCCACTTCAAAGGAAACTTGCTGTATTTTCAAAGCACCAGAAATTGGCACAAGAGCGAGAAGAGTGGAAGACAATGAGCAAGAAGGAAAACAGCCCCGCATAAACCCAAAGCGGACTCTGCTCCCTAAACGCAAAGCGACCTGTGGGTTGGAGCGCTGGGGAAAAACCCAGGCGGAGCGGAAGAAAGCGGGATAA

Function

symbol description
erbb4a Predicted to enable epidermal growth factor receptor binding activity and transmembrane receptor protein tyrosine kinase activity. Acts upstream of or within generation of neurons. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be part of receptor complex. Predicted to be active in basal plasma membrane. Predicted to be integral component of plasma membrane. Is expressed in heart and nervous system. Human ortholog(s) of this gene implicated in amyotrophic lateral sclerosis type 19; colorectal cancer; esophagus squamous cell carcinoma; hepatocellular carcinoma; and lung adenocarcinoma. Orthologous to human ERBB4 (erb-b2 receptor tyrosine kinase 4).

NR:

description
receptor tyrosine-protein kinase erbB-4 precursor

GO:

id name namespace
GO:0006468 protein phosphorylation biological_process
GO:0007169 transmembrane receptor protein tyrosine kinase signaling pathway biological_process
GO:0016020 membrane cellular_component
GO:0005524 ATP binding molecular_function
GO:0004714 transmembrane receptor protein tyrosine kinase activity molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
XM_043236152.1 True 489 mRNA 0.48 5 4221283 4232503

Neighbor

gene id symbol gene type direction distance location
LOC122352357 slitrk1,LOC107756981,LOC107570247,LOC107744763,LOC107556534 coding upstream 209913 4007775 ~ 4011370 (+)
slitrk6 slitrk6,LOC107674010,LOC107558904,LOC107730399,LOC107574216,LOC107737039,LOC107698122 coding upstream 403287 3804599 ~ 3817996 (+)
LOC122350229 gpc6a,LOC107730398,LOC107744956,LOC107553997,LOC105911916,LOC108414264,LOC100710496 coding upstream 1100463 2941770 ~ 3120820 (+)
LOC122328837 gpc6a,LOC107730398,LOC107744956,LOC107553997,LOC105911916,LOC103365236 coding upstream 1439099 2758083 ~ 2782184 (+)
rpl24 rpl24,LOC107575619,LOC107551103,LOC107751658,LOC107662676,LOC107662117 coding upstream 1478872 2739677 ~ 2742411 (+)
spry2 spry2,LOC107549433,LOC107750630,LOC107674014,LOC107676062,LOC107750049,LOC107556294 coding downstream 262691 4495194 ~ 4499239 (+)
tuba8l2 tuba8l2,LOC107750365,LOC107556293,LOC103042625,LOC108411703,LOC107549435 coding downstream 315949 4548452 ~ 4554686 (+)
stk16 stk16,LOC107674016,LOC107750290,LOC107676064 coding downstream 323002 4555505 ~ 4561710 (+)
atic atic,LOC107556291,LOC107750210,LOC107674004,LOC107549437,LOC107750055,LOC107676052 coding downstream 357528 4590031 ~ 4597077 (+)
LOC122346000 cpo,LOC107556274,LOC108440461,LOC108258336 coding downstream 412431 4644934 ~ 4649367 (+)
LOC122346127 erbb4,LOC107741926,LOC107660610,LOC107721020,LOC107662043,LOC107555909 non-coding upstream 2683 4209409 ~ 4218600 (+)
LOC122341420 NA non-coding upstream 196945 4020097 ~ 4024338 (+)
G771 NA non-coding upstream 500744 3720264 ~ 3720539 (+)
G719 NA non-coding upstream 935081 3285949 ~ 3286202 (+)
G546 NA non-coding upstream 1490563 2726300 ~ 2730720 (+)
G815 NA non-coding downstream 61550 4294053 ~ 4299198 (+)
G856 NA non-coding downstream 269738 4502241 ~ 4502477 (+)
G857 NA non-coding downstream 271029 4503532 ~ 4503821 (+)
G852 NA non-coding downstream 308487 4540990 ~ 4542948 (+)
G843 NA non-coding downstream 343641 4576144 ~ 4599814 (+)
G749 LOC107730401,LOC107558902,LOC107677853,LOC107698126,LOC107561275,LOC107737038,LOC108411062 other upstream 522190 3636707 ~ 3699093 (+)
G727 NA other upstream 880407 3334658 ~ 3340876 (+)
G482 dusp27 other upstream 1624981 2594931 ~ 2596302 (+)
G474 f10,LOC107654567,LOC107694470,LOC107751061,LOC107747060 other upstream 1694039 2524525 ~ 2527244 (+)
pcid2 pcid2 other upstream 1702898 2511572 ~ 2518385 (+)
G824 NA other downstream 124195 4356698 ~ 4357260 (+)
G826 NA other downstream 125504 4358007 ~ 4358296 (+)
prkag3a prkag3a,LOC107750059,LOC107673997,LOC107676055 other downstream 705678 4938181 ~ 4944841 (+)
gtf3c3 gtf3c3,LOC107706835,LOC107750061 other downstream 734683 4967186 ~ 4977263 (+)
hecw2b hecw2,LOC107674007,LOC107676038,LOC108258347,LOC107706834 other downstream 746622 4979125 ~ 5025914 (+)

Expression


Co-expression Network