G128467 (hipk2,LOC107722467,LOC107568633,LOC107587022,LOC107684678)


Basic Information

Item Value
gene id G128467
gene name hipk2,LOC107722467,LOC107568633,LOC107587022,LOC107684678
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056716.1
NCBI id CM032085.1
chromosome length 26409628
location 23053402 ~ 23054529 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU189613
TGGACTGCAGGTAGGTAGAGCACACCGCTTTGGAGACGTGACTAGCAGAGCCGAAGTCGATGACCTTGACCCTGTACGGTTGGCGGGCTGGGTCTACAAGCATGATGTTCTCAGGTTTCAAGTCAGCGTGGATCAGTCCGAGGCTTTTGAGCTTCATGAGGGCAGTGGCCACCTGCTGCAGGATGGGTCGGATGTACTTGAGTGGCAACGGGCTGAACTTGTTCTGCTTGAGGAAGTCGTACAGGTTCTGCTCCAACATCTCGAAGACCAGGCACGTGTGGTTCTTGTGCTGGAAGCACTCGTACGCTCGAACAAAGTTGTAGTCGTCGGCGCTCTCCGTGCTCAGCCGCGCCAGTATGCTCACCTCAATCTGGCCCTGCCGCGCATACGAAGGGTGGTTCTTGAGGATCTTGATGGCCACGATCTCGCTGGTGCCGCGTTTCCAGCACTTCACCACCTGCCCGAACGTCCCTCGACCTAGGAACTCCAGCACCTCGTAGGTGTTTGTCATGGAGCAAAGCACCTCGTGCTGCAAGAGCTGGTAGTCACCCTCGCTGTTGGCGCCGCTGTTCTTGGACGTGGCCGTGGTGGAGGCGGTCGCAGTCGCGACGGTGGCCCCACTCTGTGCGTTGTTCTGGATCATGGGTGCAGGCAGTTGCTGCTCCTCGACCACGTGCACACTGCTTCCACTGCCGTTGTTGTTGTCCAGCTCCTCGCTTTTCCGCTTAAGCCCGCATCGCTGGTACGTGTCCAGCAGACTGACGGTGCTGCGGCGCGTCAGGTTGTGACCTCCGCTGCCGCTTCCGCTGCTCCCGGTGCTGCCCAACAGTTGACCAGCCGCCCCTGACGTGCTGCTGGCCGAGGCCACTACGATGTGCCCCGAACCGGCCGGGAAGAGGAGGGCCTGTTCGTAGGACAGGGAAGAGTTGGAGACCTGGAGGCTGGCGCCGTTGATGCCCACTGGGGCGACTGAGACACTCTGCTTGCTGTTCTGACTGTAGACCTTGCTGTGCGTGCCGTACCCTGTCATATCCCAGTTGCAACTCTGCTCCACCTTCAGTTTCTTCACGCTAAAGAAGGCACTTGACTGGAGAGTGTGAGGGGAGAAGACTTGCACTTGCGAGGCCA

Function

symbol description
hipk2 Predicted to enable SMAD binding activity; protein kinase activity; and transcription corepressor activity. Predicted to contribute to transcription coactivator activity. Acts upstream of or within convergent extension and regulation of melanocyte differentiation. Predicted to be active in cytoplasm and nucleus. Predicted to colocalize with PML body. Is expressed in notochord. Orthologous to human HIPK2 (homeodomain interacting protein kinase 2).

NR:

description
PREDICTED: homeodomain-interacting protein kinase 2-like isoform X1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU189613 True 1128 lncRNA 0.59 1 23053402 23054529

Neighbor

gene id symbol gene type direction distance location
fgd4a LOC107722468,LOC107670369,LOC107587027,LOC107684651,LOC107738409 coding upstream 163902 22849926 ~ 22889500 (+)
bicd1a bicd1,LOC107722484,LOC107738411,LOC107587026 coding upstream 204359 22817357 ~ 22849043 (+)
tmtc2b LOC107673141,LOC107722480,LOC107670376,LOC107738412,LOC107587029,LOC108414015 coding upstream 290860 22668197 ~ 22762542 (+)
LOC122362983 hipk2,LOC107722467,LOC107568633,LOC107738404 coding upstream 416537 22623124 ~ 22636865 (+)
LOC122362807 srgap1a,srgap1,LOC107670373,LOC108264626 coding upstream 431214 22583917 ~ 22622188 (+)
tbxas1 tbxas1,LOC107722474,LOC107684653,LOC107587020,LOC107738402,LOC107559817 coding downstream 26498 23081027 ~ 23140905 (+)
LOC122323065 LOC107559809,LOC107684685,LOC101063805,LOC104959708,LOC102203720,LOC107587043 coding downstream 186944 23241473 ~ 23242712 (+)
LOC122362508 LOC107559815,LOC107722485,LOC107684656,LOC107666231,LOC107738399 coding downstream 190008 23244537 ~ 23250136 (+)
tat tat,LOC107666226,LOC107559814,LOC107587016,LOC107684657 coding downstream 196346 23250875 ~ 23258449 (+)
zgc:56622 zgc:56622,LOC107666229,LOC107738396,LOC107587047,LOC107722465,LOC107559805 coding downstream 207829 23262358 ~ 23266125 (+)
G128462 NA non-coding upstream 46959 23005958 ~ 23006443 (+)
G128459 NA non-coding upstream 49275 23003669 ~ 23004127 (+)
G128458 NA non-coding upstream 50747 23002435 ~ 23002655 (+)
G128454 NA non-coding upstream 51769 22997764 ~ 23001633 (+)
G128453 NA non-coding upstream 57371 22995751 ~ 22996031 (+)
G128469 NA non-coding downstream 2491 23057020 ~ 23057222 (+)
G128470 NA non-coding downstream 2858 23057387 ~ 23059941 (+)
G128475 NA non-coding downstream 12283 23066812 ~ 23067068 (+)
G128476 NA non-coding downstream 13781 23068310 ~ 23080310 (+)
G128696 NA non-coding downstream 281262 23335791 ~ 23337089 (+)
G128367 LOC107722471,LOC107738392,LOC107587041 other upstream 614723 22434806 ~ 22438679 (+)
LOC122363143 LOC107722468,LOC107587027,LOC107670369,LOC107684651,LOC107738409,LOC107559800,LOC107705337,LOC107658950,LOC107584024,LOC107656390,LOC107718551,LOC107590534 other upstream 641445 22400944 ~ 22411957 (+)
LOC122362661 zgc:77650,arf5,LOC107599973,LOC107559620,LOC108439765,LOC108439842,LOC107599983,LOC103033491 other upstream 2412343 20634845 ~ 20641059 (+)
terb1 LOC107710377,LOC107686590,LOC107559931,LOC107662840,LOC107600507,LOC107736230 other upstream 2452883 20589684 ~ 20600519 (+)
si:dkey-30c15.17 LOC107686550,LOC107559644,LOC107733274 other upstream 2496775 20551148 ~ 20556627 (+)
cdh13 cdh13,LOC107722459,LOC107684661,LOC107587012,LOC107738387,LOC107666219,LOC107553949 other downstream 402571 23457100 ~ 23736848 (+)
G128858 NA other downstream 1395236 24449765 ~ 24457560 (+)
LOC122323037 NA other downstream 1529316 24583845 ~ 24588337 (+)
kiaa0513 zgc:91860,LOC107583795,LOC107740318,LOC107686269,LOC107738753,LOC107549630 other downstream 2240214 25294743 ~ 25309740 (+)
mt2 NA other downstream 2291863 25346392 ~ 25348594 (+)

Expression


Co-expression Network