G45355



Basic Information


Item Value
gene id G45355
gene name NA
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information


Item Value
chromosome id NC_056704.1
NCBI id CM032073.1
chromosome length 27473687
location 14905502 ~ 14905708 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence


>TU67118
GGCCGACCCCCTGTCACGATTTACTAACCAAATCCATCCAGAGCTGGCGGGAGCAAAGGCTTGAAAGCAGGGGATATTGCCTGTTGTTGGGCCTGTCGAGTCAGCTATGTGTGCTCCACAGTTGAGATGGAGGCTTCGGAGGGGGTTGGAGAGGAGTACCGCTAATGCGCACACAGACATTCATTCCAATGAGAGGAGACACTTTAC

Function


GO: NA

KEGG:

id description
ko00140 Steroid hormone biosynthesis
ko00980 Metabolism of xenobiotics by cytochrome P450
ko05204 Chemical carcinogenesis - DNA adducts

RNA


RNA id representative length rna type GC content exon number start site end site
TU67118 True 207 lncRNA 0.54 1 14905502 14905708

Neighbor


gene id symbol gene type direction distance location
foxd3 foxd3,LOC107717135,LOC107591180,LOC107731647,LOC107692383,LOC107704516 coding downstream 92878 14805304 ~ 14812624 (-)
alg6 alg6,LOC107704515,LOC107692382,LOC107591199 coding downstream 103648 14789676 ~ 14801854 (-)
efcab7 efcab7,LOC107704512,LOC107731637,LOC107739082,LOC107692381,LOC107591198 coding downstream 124773 14770982 ~ 14780729 (-)
pgm1 pgm1,LOC107731639,LOC107704513,LOC107591179,LOC107739071,LOC107692428 coding downstream 135605 14762711 ~ 14769897 (-)
ror1 ror1,LOC107731648,LOC107556549,LOC107591177,LOC107739155 coding downstream 147550 14657884 ~ 14757952 (-)
atg4c atg4c,LOC107704517,LOC107731653,LOC107556554,LOC107591181,LOC107692386 coding upstream 1659 14907367 ~ 14914995 (-)
angptl3 angptl3,LOC107704519,LOC107731634,LOC107556555,LOC107717137,LOC107692388,LOC107591184 coding upstream 18431 14924139 ~ 14929125 (-)
usp1 usp1,LOC107591200,LOC107731620 coding upstream 51321 14957029 ~ 14962572 (-)
mafaa mafa,mafaa,LOC107717140,LOC107591187,LOC107556987,LOC107731633 coding upstream 176510 15082218 ~ 15086566 (-)
LOC122346854 zc3h3,LOC107731631,LOC107556980,LOC107717141,LOC107692390,LOC107704522 coding upstream 186431 15092139 ~ 15120613 (-)
LOC122346442 NA non-coding downstream 249471 14651716 ~ 14656031 (-)
G45277 NA non-coding downstream 411480 14493121 ~ 14494022 (-)
LOC122346673 NA non-coding downstream 626473 14263789 ~ 14279029 (-)
G45271 sgip1,sgip1a,LOC107739126 non-coding downstream 689226 14214638 ~ 14216276 (-)
G45270 LOC107692440 non-coding downstream 692516 14211366 ~ 14212986 (-)
G45532 NA non-coding upstream 196982 15102690 ~ 15154616 (-)
G45543 NA non-coding upstream 279444 15185152 ~ 15239640 (-)
G45544 LOC107731621,LOC107675939,LOC107556983 non-coding upstream 327559 15233267 ~ 15745536 (-)
G45560 NA non-coding upstream 413677 15319385 ~ 15320034 (-)
G45579 NA non-coding upstream 577198 15482906 ~ 15484967 (-)
G45257 ttc22,LOC107590622,LOC107692368,LOC107659045,LOC107591163 other downstream 712336 14160475 ~ 14193166 (-)
pex5la pex5la,LOC107709207,LOC107590632,LOC107659033,LOC107692357,LOC107548659,LOC107732026 other downstream 1119599 13718202 ~ 13785903 (-)
tmem131 tmem131,LOC107659030,LOC107692350,LOC107732007 other downstream 1224208 13655260 ~ 13681294 (-)
LOC122347614 rab6ba,rab6b,LOC107696768,LOC107552273,LOC102207753,LOC100696791,LOC107694122,LOC103354239 other downstream 2007784 12525756 ~ 12897718 (-)
brdt brdt,LOC107678354,LOC107749988,LOC107675431,LOC107730697,LOC107564432 other downstream 3836036 11055035 ~ 11069466 (-)
LOC122347580 ttc4,LOC107738930,LOC107659046,LOC107709194,LOC107692369 other upstream 421875 15327583 ~ 15330851 (-)
insl5a LOC107692440 other upstream 583410 15489118 ~ 15490685 (-)
LOC122346545 LOC107582692,LOC107673508,LOC107711046 other upstream 629678 15535386 ~ 15685485 (-)
G45606 sec61a1,LOC103358725,LOC108436273,LOC108440718,LOC103023094,LOC106518493,LOC102228108 other upstream 698202 15603910 ~ 15605470 (-)
LOC122347279 LOC107556984,LOC107731622,LOC107692431,LOC107675940,LOC107594634,LOC107717133 other upstream 850601 15756309 ~ 15765107 (-)

Expression



Co-expression Network