G28947


Basic Information

Item Value
gene id G28947
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 8882396 ~ 8882600 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU32734
TAAAAACACTAGGGGGCGGTAGACAATAAGAGACAATGAGCTACACCAGTTTGGGAGACCCATCACAGCGCTGGATACATCAGTTCACTTCATTCAAGCAGAACACTCATTTCTTTCCTTGTTAAACAGCAAAATGATCCTTGACCCTGTTTTCCAGCTGAATTCAGTAAGGTGAGAAGAATCATGATAACGTTTCTTTAGGTAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU32734 True 205 lncRNA 0.35 1 8882396 8882600

Neighbor

gene id symbol gene type direction distance location
CI01000004_08875722_08877149 GM11353, RPS8A, RPS8 coding upstream 4889 8875722 ~ 8877507 (+)
CI01000004_08866163_08873681 HECTD3 coding upstream 8600 8866034 ~ 8873796 (+)
CI01000004_08823382_08844233 NA coding upstream 38051 8822749 ~ 8844345 (+)
CI01000004_08806791_08812203 NA coding upstream 69834 8806791 ~ 8812562 (+)
CI01000004_08746864_08765484 NA coding upstream 116491 8746484 ~ 8765905 (+)
CI01000004_08947119_08949558 NA coding downstream 64519 8947119 ~ 8949644 (+)
CI01000004_08976512_08980033 TTPA coding downstream 93654 8976254 ~ 8980984 (+)
CI01000004_08987501_08991239 NA coding downstream 104558 8987158 ~ 8991469 (+)
CI01000004_08996083_08997863 NA coding downstream 113483 8996083 ~ 8997863 (+)
CI01000004_09002274_09004879 IMPA1, IMPA1.3 coding downstream 119442 9002042 ~ 9005023 (+)
G28933 NA non-coding upstream 20486 8861235 ~ 8861910 (+)
G28909 NA non-coding upstream 199391 8682707 ~ 8683005 (+)
G28905 NA non-coding upstream 208195 8673758 ~ 8674201 (+)
G28904 NA non-coding upstream 208933 8673221 ~ 8673463 (+)
G28872 NA non-coding upstream 265861 8616221 ~ 8616535 (+)
G28955 NA non-coding downstream 12862 8895462 ~ 8896242 (+)
G28959 NA non-coding downstream 23572 8906172 ~ 8906381 (+)
G28968 NA non-coding downstream 39883 8922483 ~ 8922685 (+)
G28969 NA non-coding downstream 40122 8922722 ~ 8922940 (+)
G28971 NA non-coding downstream 43195 8925795 ~ 8926080 (+)
G28859 NA other upstream 282793 8599235 ~ 8599603 (+)
CI01000004_08414451_08436256 NA other upstream 431169 8414316 ~ 8439933 (+)
CI01000004_07654234_07655677 MRPL34 other upstream 1226013 7654234 ~ 7656383 (+)
CI01000004_06571261_06572539 SEP15 other upstream 2307975 6570771 ~ 6572667 (+)
G28302 NA other upstream 2380309 6470028 ~ 6502087 (+)
G30797 NA other downstream 1614776 10497376 ~ 10497788 (+)
G31710 NA other downstream 2754651 11637251 ~ 11642400 (+)
CI01000004_11666900_11667179 NA other downstream 2782173 11666900 ~ 11667659 (+)
G31865 NA other downstream 3309530 12192130 ~ 12197418 (+)

Expression


Co-expression Network