G62263 (lrriq3,LOC107657910,LOC107585823,LOC107699824,LOC107548466)


Basic Information

Item Value
gene id G62263
gene name lrriq3,LOC107657910,LOC107585823,LOC107699824,LOC107548466
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056706.1
NCBI id CM032075.1
chromosome length 24299999
location 9006834 ~ 9007105 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU92223
TTGAATCGAACAGGAAGAGACAAGTTTTGTACGATTTCCTCATCAGAGATGACAAAGTTGTCCAAGGCCTTCAATGACCATATGCTGTTGACCAGACAGTGCCTGTAGCTCTTCTTTAAACTGAGCGGGGTGTCATAGAGAGTTAAAGCAGTCAGTTTTAAACAGCCAGACAGGCCTTTAATACTGTTCCAGGTTGACATGTTGTTGTCGTGTAGATACAGAAGTTGCAATTCTTTCAGATTATTCCAACATGAAGCATCAGGGAGCTGAAC

Function

symbol description
lrriq3 Orthologous to human LRRIQ3 (leucine rich repeats and IQ motif containing 3).

NR:

description
PREDICTED: leucine-rich repeat and IQ domain-containing protein 3-like isoform X2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU92223 True 272 lncRNA 0.42 1 9006834 9007105

Neighbor

gene id symbol gene type direction distance location
fpgt fpgt,LOC107699845,LOC107585822,LOC107548491 coding downstream 831 9002221 ~ 9006003 (-)
tnni3k tnni3k,LOC107743849,LOC107550356,LOC107699804,LOC107657874,LOC107710912 coding downstream 4872 8991343 ~ 9001962 (-)
LOC122350776 LOC107599836,LOC107657909,LOC107710921,LOC107743853,LOC107548462 coding downstream 30894 8972793 ~ 8975940 (-)
st6galnac5b st6galnac5b,LOC107599835,LOC107657873,LOC107710911,LOC107743856,LOC107550326,LOC107700626 coding downstream 72083 8922693 ~ 8934751 (-)
prkcz prkcz,LOC107710919,LOC107743854,LOC107548418 coding downstream 94847 8820356 ~ 8911987 (-)
acot11b LOC107710923,LOC107585821,LOC107657911,LOC107548485,LOC107743846 coding upstream 2621 9009726 ~ 9018000 (-)
rps8b LOC107743876,LOC107710907,LOC107579213 coding upstream 103286 9110391 ~ 9113350 (-)
elovl8b elovl8b,LOC107657928,LOC107585829,LOC107743843,LOC107699894,LOC108442366,LOC103026255 coding upstream 106382 9113487 ~ 9116378 (-)
mutyh mutyh,LOC107657919,LOC107585828,LOC107743842,LOC107750490,LOC103399401 coding upstream 109515 9116620 ~ 9121780 (-)
armh1 si:ch211-241d21.5,LOC107750499,LOC107699909,LOC107548505 coding upstream 115344 9122449 ~ 9127648 (-)
G62262 NA non-coding downstream 55 9006555 ~ 9006779 (-)
G62255 NA non-coding downstream 34061 8968289 ~ 8972773 (-)
LOC122351086 NA non-coding downstream 64579 8936078 ~ 8942255 (-)
G62241 NA non-coding downstream 85138 8921481 ~ 8921696 (-)
G62235 NA non-coding downstream 85930 8918758 ~ 8920904 (-)
G62250 dio1,LOC107700640 non-coding upstream 23760 9030865 ~ 9038700 (-)
G62293 glis1,LOC102303521 non-coding upstream 75690 9082795 ~ 9085194 (-)
G62519 NA non-coding upstream 401309 9408414 ~ 9414439 (-)
G62525 NA non-coding upstream 519522 9526627 ~ 9526966 (-)
G62564 NA non-coding upstream 695854 9702959 ~ 9703191 (-)
pola2 pola2,LOC107599808,LOC107657899 other downstream 349548 8652304 ~ 8657286 (-)
mrps36 mrps36,LOC107657871,LOC107599810,LOC107699743,LOC107743861,LOC107548364,LOC107710901 other downstream 356851 8647270 ~ 8649983 (-)
eps15 eps15,LOC107752431,LOC107599798,LOC107743869 other downstream 590281 8392345 ~ 8416553 (-)
LOC122350139 elavl4 other downstream 774060 8117008 ~ 8232774 (-)
spata6 LOC107657881,LOC107699473,LOC107549716,LOC107757996,LOC107599047 other downstream 1319272 7677496 ~ 7687562 (-)
mindy4 LOC107699968,LOC107585839,LOC107548580 other upstream 250138 9257243 ~ 9262826 (-)
fam78bb fam78bb,LOC107717547,LOC107676968,LOC107751100,LOC107550401,LOC107585866,LOC107695225 other upstream 693289 9700394 ~ 9708621 (-)
mllt1a mllt1a,LOC107731200,LOC107676782,LOC107695250,LOC107549968,LOC107585916 other upstream 947576 9954681 ~ 9969485 (-)
adamts10 adamts10,LOC107676806,LOC107585873,LOC107731268,LOC107695212,LOC107549976,LOC106613844 other upstream 988442 9995547 ~ 10041769 (-)
smim24 smim24,LOC107580287 other upstream 1238091 10245196 ~ 10248156 (-)

Expression


Co-expression Network