G62293 (glis1,LOC102303521)


Basic Information

Item Value
gene id G62293
gene name glis1,LOC102303521
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056706.1
NCBI id CM032075.1
chromosome length 24299999
location 9082795 ~ 9085194 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU92265
AGTGGATCTTCACATGCTTGCGGAGGGAACTGGGGTCTGTGTAGCGTTTAGTGCAGCCCGGGATCTGACATGCATATGGTTTCTGTCACAGTGTCCAGATGTGTGCGCTGGTGCTTTGCTCTGTCGCTAGAGTTGCTGAATGCTTTTTGACAGCCTGGATGCTGGCACAGGTACGGCTTCTCTCCTGTGTGACTCCGCAGGTGAATCTTCAGATTCTCCAGCCGTGAGAAAGCCTTGTTACACCC

Function

symbol description
glis1 Enables sequence-specific double-stranded DNA binding activity. Predicted to be involved in negative regulation of transcription by RNA polymerase II and positive regulation of transcription by RNA polymerase II. Predicted to act upstream of or within positive regulation of transcription, DNA-templated. Predicted to be active in nucleus.

NR:

description
PREDICTED: zinc finger protein GLIS1 isoform X3

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU92265 True 245 lncRNA 0.53 2 9082795 9085194

Neighbor

gene id symbol gene type direction distance location
acot11b LOC107710923,LOC107585821,LOC107657911,LOC107548485,LOC107743846 coding downstream 64795 9009726 ~ 9018000 (-)
fpgt fpgt,LOC107699845,LOC107585822,LOC107548491 coding downstream 76792 9002221 ~ 9006003 (-)
tnni3k tnni3k,LOC107743849,LOC107550356,LOC107699804,LOC107657874,LOC107710912 coding downstream 80833 8991343 ~ 9001962 (-)
LOC122350776 LOC107599836,LOC107657909,LOC107710921,LOC107743853,LOC107548462 coding downstream 106855 8972793 ~ 8975940 (-)
st6galnac5b st6galnac5b,LOC107599835,LOC107657873,LOC107710911,LOC107743856,LOC107550326,LOC107700626 coding downstream 148044 8922693 ~ 8934751 (-)
rps8b LOC107743876,LOC107710907,LOC107579213 coding upstream 25197 9110391 ~ 9113350 (-)
elovl8b elovl8b,LOC107657928,LOC107585829,LOC107743843,LOC107699894,LOC108442366,LOC103026255 coding upstream 28293 9113487 ~ 9116378 (-)
mutyh mutyh,LOC107657919,LOC107585828,LOC107743842,LOC107750490,LOC103399401 coding upstream 31426 9116620 ~ 9121780 (-)
armh1 si:ch211-241d21.5,LOC107750499,LOC107699909,LOC107548505 coding upstream 37255 9122449 ~ 9127648 (-)
guk1b guk1b,LOC107585833,LOC107758268,LOC107657930,LOC107750510,LOC103024702,LOC108442369,LOC105895130,LOC106905753 coding upstream 42679 9127873 ~ 9131091 (-)
G62250 dio1,LOC107700640 non-coding downstream 44095 9030865 ~ 9038700 (-)
G62263 lrriq3,LOC107657910,LOC107585823,LOC107699824,LOC107548466 non-coding downstream 75690 9006834 ~ 9007105 (-)
G62262 NA non-coding downstream 76016 9006555 ~ 9006779 (-)
G62255 NA non-coding downstream 110022 8968289 ~ 8972773 (-)
LOC122351086 NA non-coding downstream 140540 8936078 ~ 8942255 (-)
G62519 NA non-coding upstream 323220 9408414 ~ 9414439 (-)
G62525 NA non-coding upstream 441433 9526627 ~ 9526966 (-)
G62564 NA non-coding upstream 617765 9702959 ~ 9703191 (-)
G62565 NA non-coding upstream 618182 9703376 ~ 9703598 (-)
G62567 NA non-coding upstream 623779 9708973 ~ 9709221 (-)
pola2 pola2,LOC107599808,LOC107657899 other downstream 425509 8652304 ~ 8657286 (-)
mrps36 mrps36,LOC107657871,LOC107599810,LOC107699743,LOC107743861,LOC107548364,LOC107710901 other downstream 432812 8647270 ~ 8649983 (-)
eps15 eps15,LOC107752431,LOC107599798,LOC107743869 other downstream 666242 8392345 ~ 8416553 (-)
LOC122350139 elavl4 other downstream 850021 8117008 ~ 8232774 (-)
spata6 LOC107657881,LOC107699473,LOC107549716,LOC107757996,LOC107599047 other downstream 1395233 7677496 ~ 7687562 (-)
mindy4 LOC107699968,LOC107585839,LOC107548580 other upstream 172049 9257243 ~ 9262826 (-)
fam78bb fam78bb,LOC107717547,LOC107676968,LOC107751100,LOC107550401,LOC107585866,LOC107695225 other upstream 615200 9700394 ~ 9708621 (-)
mllt1a mllt1a,LOC107731200,LOC107676782,LOC107695250,LOC107549968,LOC107585916 other upstream 869487 9954681 ~ 9969485 (-)
adamts10 adamts10,LOC107676806,LOC107585873,LOC107731268,LOC107695212,LOC107549976,LOC106613844 other upstream 910353 9995547 ~ 10041769 (-)
smim24 smim24,LOC107580287 other upstream 1160002 10245196 ~ 10248156 (-)

Expression


Co-expression Network