G30169


Basic Information

Item Value
gene id G30169
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 9418545 ~ 9418760 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU34145
TCAGAATTTAATTCCTGAATTTGAATTAAATAGAAAACAGGATGCAGAATTGCAATTCAAATTTGAATGTAAGGAAGAAATGAACTGAAAATGAATTGAAATTCAAAGAAATTCATAAAATTGTTGTTTTTAAAGCAAACATTGATGAAAATGTTTGGCAGGGAGAACAATGGTTATAGTTTATATTCCATCATATTTGATTAAAGGGGTGGTTAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU34145 True 216 lncRNA 0.39 1 9418545 9418760

Neighbor

gene id symbol gene type direction distance location
CI01000004_09383327_09385444 ELOVL8A coding upstream 33051 9383327 ~ 9385494 (+)
CI01000004_09378220_09381425 NA coding upstream 36722 9377804 ~ 9381823 (+)
CI01000004_09371639_09375356 NA coding upstream 42540 9371639 ~ 9376005 (+)
CI01000004_09340611_09363638 TESK2 coding upstream 54291 9339540 ~ 9364254 (+)
CI01000004_09224465_09224950 NA coding upstream 193589 9222479 ~ 9224956 (+)
CI01000004_09429758_09474615 ZSWIM5 coding downstream 10998 9429758 ~ 9474615 (+)
CI01000004_09524214_09525580 TMEM68 coding downstream 105454 9524214 ~ 9525580 (+)
CI01000004_09526514_09528258 TMEM68 coding downstream 107754 9526514 ~ 9528313 (+)
CI01000004_09533613_09534019 NA coding downstream 114481 9533241 ~ 9534363 (+)
CI01000004_09623579_09626179 BUC coding downstream 204819 9623579 ~ 9626601 (+)
G30163 NA non-coding upstream 5984 9412229 ~ 9412561 (+)
G30111 NA non-coding upstream 91841 9323558 ~ 9326704 (+)
G30131 NA non-coding upstream 107724 9310597 ~ 9310821 (+)
G30130 NA non-coding upstream 107984 9310359 ~ 9310561 (+)
G30129 NA non-coding upstream 108691 9308160 ~ 9309854 (+)
G30172 NA non-coding downstream 4885 9423645 ~ 9423845 (+)
G30177 NA non-coding downstream 7355 9426115 ~ 9426347 (+)
G30196 NA non-coding downstream 196997 9615757 ~ 9616188 (+)
G30190 NA non-coding downstream 197887 9616647 ~ 9617267 (+)
G30243 NA non-coding downstream 261826 9680586 ~ 9680809 (+)
CI01000004_08976512_08980033 TTPA other upstream 437561 8976254 ~ 8980984 (+)
G28859 NA other upstream 818942 8599235 ~ 8599603 (+)
CI01000004_08414451_08436256 NA other upstream 967318 8414316 ~ 8439933 (+)
CI01000004_07654234_07655677 MRPL34 other upstream 1762162 7654234 ~ 7656383 (+)
CI01000004_06571261_06572539 SEP15 other upstream 2844124 6570771 ~ 6572667 (+)
G30797 NA other downstream 1078616 10497376 ~ 10497788 (+)
G31710 NA other downstream 2218491 11637251 ~ 11642400 (+)
CI01000004_11666900_11667179 NA other downstream 2246013 11666900 ~ 11667659 (+)
G31865 NA other downstream 2773370 12192130 ~ 12197418 (+)
CI01000004_12646972_12652534 NA other downstream 3223994 12646838 ~ 12652570 (+)

Expression


Co-expression Network