G137951 (arhgap21b,LOC108267702)


Basic Information

Item Value
gene id G137951
gene name arhgap21b,LOC108267702
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035912.1
NCBI id CM008315.1
chromosome length 41032606
location 2244516 ~ 2245661 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU186644
CCGTCTTCTTTAAAGAACCAGTCATATTGTTGAATTAATGTCTCCACAATTTTGTACTGGTCAGGCATATGTGTAACCATGTGGGTCATGTTATCTTCAGACGTTCTGACCAAGGTTGGTCCAAATACAATAGCCAGGTTACGAGGCTCCATCTTATTCTTCTCACAGTGCTCAGAAACAGTCTTAAGATGTCCAGAGAGGAACTTCAGGGTTTCGTAATGATGGTCAGGCAGCTCATGGATCAGTCGTTTCAGTACTTTTAACCGCTCCACTCCGTTTACT

Function

symbol description
arhgap21b Predicted to enable GTPase activator activity and phospholipid binding activity. Predicted to act upstream of or within signal transduction. Orthologous to human ARHGAP21 (Rho GTPase activating protein 21).

NR:

description
rho GTPase-activating protein 21 isoform X3

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU186644 True 282 lncRNA 0.43 4 2244516 2245661

Neighbor

gene id symbol gene type direction distance location
dpp6 LOC108430761,LOC108267703 coding upstream 14451 2102221 ~ 2230065 (+)
LOC103042278 NA coding upstream 329497 1869474 ~ 1915019 (+)
kdsr kdsr,LOC106569188,LOC102792240 coding upstream 384001 1855297 ~ 1860515 (+)
LOC103043726 LOC103043726,LOC105899208 coding upstream 427304 1810725 ~ 1817212 (+)
tsc22d2 NA coding upstream 442197 1777225 ~ 1802319 (+)
LOC103042593 LOC108430758 coding downstream 76377 2322038 ~ 2362870 (+)
LOC103040438 pcyt1a,LOC103040438,LOC108430756,LOC108267677,LOC107709348,LOC107671662,LOC107727528 coding downstream 150296 2395957 ~ 2405369 (+)
LOC103040954 anxa13,anxa13l,LOC103040954,LOC107727547,LOC108267681,LOC107559374 coding downstream 177247 2422908 ~ 2431028 (+)
LOC103041271 LOC108430753 coding downstream 219670 2465331 ~ 2473513 (+)
tsen15 tsen15,LOC107681748 coding downstream 228400 2474061 ~ 2476180 (+)
G137943 LOC108430760 non-coding upstream 6826 2207367 ~ 2237690 (+)
G137930 NA non-coding upstream 215708 2025193 ~ 2028808 (+)
G137917 LOC108430762,LOC108267465 non-coding upstream 256050 1987814 ~ 1988466 (+)
G137902 NA non-coding upstream 319661 1921553 ~ 1924855 (+)
G137831 NA non-coding upstream 326105 1916147 ~ 1918411 (+)
G137960 NA non-coding downstream 43431 2289092 ~ 2292464 (+)
G137965 LOC108430757 non-coding downstream 104973 2350634 ~ 2371378 (+)
G137972 NA non-coding downstream 140849 2386510 ~ 2480525 (+)
G137973 NA non-coding downstream 144532 2390193 ~ 2390812 (+)
G137975 NA non-coding downstream 148335 2393996 ~ 2394911 (+)
G137929 NA other upstream 220130 2022755 ~ 2024386 (+)
LOC103042893 vps4b,LOC107727524,LOC107681797,LOC107710065 other upstream 393203 1835477 ~ 1851313 (+)
G137826 LOC108430781,LOC108267757 other upstream 744560 1491816 ~ 1499956 (+)
mrps14 mrps14 other upstream 1204546 1037861 ~ 1039970 (+)
G137756 kiaa0040 other upstream 1255878 980980 ~ 988638 (+)
LOC103045052 cfap57,LOC106594647 other downstream 654814 2900475 ~ 2936129 (+)
LOC103024858 NA other downstream 836395 3082056 ~ 3084865 (+)
LOC103026108 selenot,selt1a,LOC107681817,LOC107708642 other downstream 869759 3115420 ~ 3119488 (+)
LOC103047488 pls1,LOC108437523,LOC107722705,LOC107656864,LOC107565818,LOC107599860,LOC107709028,LOC107681752 other downstream 1556192 3801853 ~ 3839372 (+)
G138701 NA other downstream 1587594 3833255 ~ 3834460 (+)

Expression


Co-expression Network