G77559 (thbs1,LOC107668245,LOC107756566,LOC102310807,LOC101487021,LOC102776654)


Basic Information

Item Value
gene id G77559
gene name thbs1,LOC107668245,LOC107756566,LOC102310807,LOC101487021,LOC102776654
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035905.1
NCBI id CM008308.1
chromosome length 42966623
location 2320215 ~ 2321005 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU104595
AGTCGATCTGGTCTGGGTTGGGGGCCAGTCTGCAGTTGTCTTTGTCGTCAGGAACACCGTCGTTGTCGTCATCGTGGTCGCAGGCGTCTCCCTTGCCGTCCTTGTCGTGGTCGGCCTGGTTGGCGTTGGGGATGTACGGGCAGTTGTCCAGATTGTTCTGATGGCCGTCCTCGTCGATGTCCTGATTGCTGTCGCACTTGTCGCCCACATTATCTGAATCTGAGTCGATCTGATCAGGATTGTGC

Function

symbol description
thbs1 Enables several functions, including collagen V binding activity; fibrinogen binding activity; and fibroblast growth factor binding activity. Involved in several processes, including regulation of cell migration; regulation of gene expression; and regulation of signal transduction. Acts upstream of or within several processes, including negative regulation of endothelial cell chemotaxis; negative regulation of endothelial cell proliferation; and negative regulation of nitric oxide mediated signal transduction. Located in several cellular components, including external side of plasma membrane; extracellular space; and platelet alpha granule. Part of fibrinogen complex. Colocalizes with collagen-containing extracellular matrix. Implicated in cholangiocarcinoma; pancreatic cancer; and pancreatic ductal carcinoma. Biomarker of COVID-19; cholangiocarcinoma; obesity; pancreatic cancer (multiple); and urinary bladder cancer.

NR:

description
PREDICTED: thrombospondin-1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU104595 True 245 lncRNA 0.57 2 2320215 2321005

Neighbor

gene id symbol gene type direction distance location
fsip1 NA coding upstream 7553 2247051 ~ 2312662 (+)
dnajc17 dnajc17 coding upstream 173939 2087613 ~ 2146276 (+)
LOC107197725 LOC108430641,LOC108269631 coding upstream 465337 1836789 ~ 1854878 (+)
LOC103033947 LOC107560184,LOC107678711,LOC107726575 coding upstream 489120 1805947 ~ 1831095 (+)
spint1 NA coding upstream 568107 1734621 ~ 1752108 (+)
LOC103026471 LOC100304858 coding downstream 144305 2465310 ~ 2468562 (+)
LOC103026149 LOC108430664,LOC108269450,LOC107567345,LOC107678748,LOC107743909 coding downstream 150393 2471398 ~ 2474791 (+)
LOC103030398 LOC108430666,LOC106610840,LOC105908184,LOC108270264 coding downstream 439665 2760670 ~ 2864439 (+)
eif2ak4 eif2ak4,LOC107673787 coding downstream 587604 2908609 ~ 2957430 (+)
tecpr2 tecpr2,LOC107758275 coding downstream 940786 3261791 ~ 3296653 (+)
G77533 NA non-coding upstream 2735 2293289 ~ 2317480 (+)
G77544 NA non-coding upstream 16385 2261986 ~ 2303830 (+)
G77534 NA non-coding upstream 30207 2197010 ~ 2290008 (+)
G77532 NA non-coding upstream 129551 2190322 ~ 2190664 (+)
G77531 NA non-coding upstream 134263 2184869 ~ 2185952 (+)
G77566 acp7 non-coding downstream 78994 2399999 ~ 2452445 (+)
G77569 NA non-coding downstream 90522 2411527 ~ 2422946 (+)
G77575 NA non-coding downstream 130422 2451427 ~ 2477003 (+)
G77711 NA non-coding downstream 381194 2702199 ~ 2713270 (+)
G77712 NA non-coding downstream 398118 2719123 ~ 2743611 (+)
LOC103033080 akt1,zbtb42,LOC107716055,LOC106610857,LOC106582697 other upstream 310797 1912532 ~ 2009418 (+)
zfyve19 zfyve19 other upstream 611918 1697965 ~ 1708297 (+)
G77471 bub1b other upstream 623234 1693356 ~ 1696981 (+)
c9h15orf52 NA other upstream 757035 1528970 ~ 1563180 (+)
G77410 NA other upstream 835165 1484670 ~ 1485050 (+)
LOC103031026 NA other downstream 137440 2458445 ~ 2464321 (+)
G77722 NA other downstream 579129 2900134 ~ 2978094 (+)
traf3 traf3,LOC107719479,LOC107694716,LOC107733154,LOC107590913 other downstream 1001080 3322085 ~ 3359744 (+)
g2e3 g2e3 other downstream 1444775 3765780 ~ 3824872 (+)
G78111 pole2 other downstream 1968502 4289507 ~ 4298184 (+)

Expression


Co-expression Network