CI01000009_09783235_09785477 (IL17D)


Basic Information

Item Value
gene id CI01000009_09783235_09785477
gene name IL17D
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000009
NCBI id null
chromosome length 16003125
location 9783235 ~ 9785563 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000009_09783235_09785477.mRNA
CTCGCGCCTCCAGAGCGCCAGAATCTGACCTGTCAATCAGCGTCTCGTCTAGCGCGCGACAGACCACGTACCCCAGTAAACTTCCTCAGCCTCTCGCCGTGGGCGTACAGGGATGCCTGACCGGGCCAAATGGGGAGGAAAGTGACCGCTTCCGAAGCACCCCAGTGTATATGCCAACCGTCATACTACGCCGTACTGGCTTGTGTGTCGGGGGTCGCCATTCCTACACGGAGAGCTACGTGTCCATCGCCGTGGGCTGTACTTGTGTGCCATTGTTGGAAAGAGACAGAAAAAGACAGCAGAGCAAGCCAAGTGTGCAAAAAATCACATCTAAAAATTCAGTTTCCAGCACCTTTAGAAAGAATTAACTGAACTGATCCATTTTTATTTTTTTTCTCTCTCTTTAAATTTTTCTTATTTCTTTCATTTTTGCTCTCACTAACTGAAAGAAAAA

Function

symbol description
il17d Predicted to enable cytokine activity. Acts upstream of or within cellular response to lipopolysaccharide. Predicted to be located in extracellular space. Is expressed in gill and spleen. Orthologous to human IL17D (interleukin 17D).

GO:

id name namespace
GO:0005126 cytokine receptor binding molecular_function

KEGG:

id description
K05492 IL17D, IL27; interleukin 17D

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000009_09783235_09785477.mRNA True 454 mRNA 0.48 2 9783235 9785563

Neighbor

gene id symbol gene type direction distance location
CI01000009_09770695_09782443 IFT88 coding upstream 699 9770695 ~ 9782536 (+)
CI01000009_09716074_09733349 ZMYM2 coding upstream 48857 9714372 ~ 9734378 (+)
CI01000009_09700487_09709797 MPHOSPH8 coding upstream 73252 9700487 ~ 9709983 (+)
CI01000009_09685457_09693885 AFF3 coding upstream 89347 9685457 ~ 9693888 (+)
CI01000009_09542674_09559750 NA coding upstream 223198 9540212 ~ 9560037 (+)
CI01000009_09853929_09854476 SAP18 coding downstream 68366 9853929 ~ 9856587 (+)
CI01000009_09866000_09866290 NA coding downstream 80160 9865723 ~ 9867040 (+)
CI01000009_09878612_09881564 POPDC2 coding downstream 93049 9878612 ~ 9881894 (+)
CI01000009_09952526_09962840 WARS2 coding downstream 166963 9952526 ~ 9964279 (+)
CI01000009_09967529_09989449 TBX15 coding downstream 181821 9967384 ~ 9989467 (+)
G56320 NA non-coding upstream 114056 9668742 ~ 9669179 (+)
G56306 NA non-coding upstream 128509 9647928 ~ 9654726 (+)
G56243 NA non-coding upstream 294691 9488185 ~ 9488544 (+)
G56242 NA non-coding upstream 296427 9486599 ~ 9486808 (+)
G56204 NA non-coding upstream 299265 9482094 ~ 9483970 (+)
G56383 NA non-coding downstream 87669 9873232 ~ 9876664 (+)
G56411 NA non-coding downstream 107270 9892833 ~ 9897455 (+)
G56412 NA non-coding downstream 112164 9897727 ~ 9898245 (+)
G56384 NA non-coding downstream 114124 9899687 ~ 9906776 (+)
G56100 NA other upstream 652949 9129300 ~ 9130286 (+)
G53651 NA other upstream 3534843 6245564 ~ 6248392 (+)
CI01000009_05931829_05943829 KCNH3 other upstream 3850434 5931718 ~ 5943899 (+)
G53388 NA other upstream 4244181 5522242 ~ 5540638 (+)
CI01000009_03202999_03207060 MPC2, MPC2.S other upstream 6574251 3202207 ~ 3208984 (+)
CI01000009_11761868_11765848 ORMDL1.S, ORMDL1 other downstream 1975223 11761606 ~ 11766944 (+)
G57811 NA other downstream 2148379 11933942 ~ 11935251 (+)
CI01000009_12432736_12435509 NA other downstream 2646995 12432538 ~ 12436017 (+)
G57682 NA other downstream 3039906 12825469 ~ 12892339 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location