CI01000009_09853929_09854476 (SAP18)


Basic Information

Item Value
gene id CI01000009_09853929_09854476
gene name SAP18
gene type misc
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000009
NCBI id null
chromosome length 16003125
location 9853929 ~ 9856587 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000009_09853929_09854476.mRNA
ACATGCCCACTTCTCCTGAGAGTGTTCACCACCAACAATGGAAGGCACCATCGCATGGACGAGTTTGCCCGGGGGAATGTACCATCTAGCGAGCTTCAGATTTATACATGGATGGATGCTACTTTGAAGGAACTGACAAGCCTGGTGAAGGAAGTCTATCCAGAAGCTAGAAAGAAAGGCACACATTTTGGGTTTGCCATCGTTTACCCAGACCCTAAACGACAAATCTACAGGGTTAAAGAGATTGGCAATACAGTTTCGGGACGCAAAGGTGCAGATGACTCCATGACGCTTCAGTCTCAACGCTTTCAGATTGGAGATTACCTCGACATCGCGATCACTCCACCTAACCGTGCACCACCTCTCCAAGGACGCATGAGACCCTACTGAAATAAGACTTGCCTGCATTTAAACAA

Function

symbol description
sap18 Predicted to enable transcription corepressor activity. Predicted to be involved in negative regulation of transcription, DNA-templated. Predicted to be active in nucleus. Orthologous to human SAP18 (Sin3A associated protein 18).

GO:

id name namespace
GO:0016607 nuclear speck cellular_component

KEGG:

id description
K14324 SAP18; histone deacetylase complex subunit SAP18

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000009_09853929_09854476.mRNA False 416 mRNA 0.48 3 9853929 9854502

Neighbor

gene id symbol gene type direction distance location
CI01000009_09783235_09785477 IL17D coding upstream 68366 9783235 ~ 9785563 (+)
CI01000009_09770695_09782443 IFT88 coding upstream 71393 9770695 ~ 9782536 (+)
CI01000009_09716074_09733349 ZMYM2 coding upstream 119551 9714372 ~ 9734378 (+)
CI01000009_09700487_09709797 MPHOSPH8 coding upstream 143946 9700487 ~ 9709983 (+)
CI01000009_09685457_09693885 AFF3 coding upstream 160041 9685457 ~ 9693888 (+)
CI01000009_09866000_09866290 NA coding downstream 11221 9865723 ~ 9867040 (+)
CI01000009_09878612_09881564 POPDC2 coding downstream 24110 9878612 ~ 9881894 (+)
CI01000009_09952526_09962840 WARS2 coding downstream 98024 9952526 ~ 9964279 (+)
CI01000009_09967529_09989449 TBX15 coding downstream 112882 9967384 ~ 9989467 (+)
CI01000009_10103558_10119209 GDAP2 coding downstream 249056 10103558 ~ 10119220 (+)
G56320 NA non-coding upstream 184750 9668742 ~ 9669179 (+)
G56306 NA non-coding upstream 199203 9647928 ~ 9654726 (+)
G56243 NA non-coding upstream 365385 9488185 ~ 9488544 (+)
G56242 NA non-coding upstream 367121 9486599 ~ 9486808 (+)
G56204 NA non-coding upstream 369959 9482094 ~ 9483970 (+)
G56383 NA non-coding downstream 18730 9873232 ~ 9876664 (+)
G56411 NA non-coding downstream 38331 9892833 ~ 9897455 (+)
G56412 NA non-coding downstream 43225 9897727 ~ 9898245 (+)
G56384 NA non-coding downstream 45185 9899687 ~ 9906776 (+)
G56100 NA other upstream 723643 9129300 ~ 9130286 (+)
G53651 NA other upstream 3605537 6245564 ~ 6248392 (+)
CI01000009_05931829_05943829 KCNH3 other upstream 3921128 5931718 ~ 5943899 (+)
G53388 NA other upstream 4314875 5522242 ~ 5540638 (+)
CI01000009_03202999_03207060 MPC2, MPC2.S other upstream 6644945 3202207 ~ 3208984 (+)
CI01000009_11761868_11765848 ORMDL1.S, ORMDL1 other downstream 1906284 11761606 ~ 11766944 (+)
G57811 NA other downstream 2079440 11933942 ~ 11935251 (+)
CI01000009_12432736_12435509 NA other downstream 2578056 12432538 ~ 12436017 (+)
G57682 NA other downstream 2970967 12825469 ~ 12892339 (+)
G57691 NA other downstream 3051942 12906444 ~ 12918465 (+)

Expression


Co-expression Network