G51122


Basic Information

Item Value
gene id G51122
gene name NA
gene type unknown
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000009
NCBI id null
chromosome length 16003125
location 1680146 ~ 1681966 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU58233
GCCCCTGATATGCATTTTGGCGATCATCTCTGCAGTGTAGAGGAACATCAGCAGTGTGTCCAGGGTGAAGGTGACATACTGCAGGGGCGGGTAGTGCTCAAAGGTCTTAGGTGTATTCATACAGACCGAAATGACACTGATTATAGCACAGGCCCGCAGGAGAGAATGAACCCATGGTTTGTTGATCCAAAGAATGTCAGCACTGTCTGTCAGTGTTTCATCTGGTCCAAAGTCGGTCATGGGCTGGGCCTCGACCCGCGAGCTCTGCTTCCTCTTCAGCATGCTTGGGCTCGCTGTGCTATAGAGAGAGTGGATGGTCAGGCTCCTCATTGGTGCATTCATCCCCGG

Function

NR:

description
Transposable element Tcb1 transposase

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU58233 True 348 TUCP 0.53 3 1680146 1681966

Neighbor

gene id symbol gene type direction distance location
CI01000009_01570544_01595199 NA coding upstream 84680 1570079 ~ 1595466 (+)
CI01000009_01454610_01484907 NA coding upstream 194318 1453708 ~ 1485828 (+)
CI01000009_01431700_01434463 NA coding upstream 245604 1429873 ~ 1435328 (+)
CI01000009_01402330_01407372 ZIC2A, ZIC2 coding upstream 272391 1401061 ~ 1407755 (+)
CI01000009_01351236_01380055 CLYBL coding upstream 299861 1351236 ~ 1380285 (+)
CI01000009_01692563_01725364 ITGBL1 coding downstream 10597 1692563 ~ 1725364 (+)
CI01000009_01733394_01738937 ITGBL1 coding downstream 49328 1731294 ~ 1739468 (+)
CI01000009_01892219_01893628 NA coding downstream 210253 1892219 ~ 1893754 (+)
CI01000009_01897343_01919208 PIKFYVE coding downstream 215377 1897343 ~ 1919516 (+)
CI01000009_01966898_01976924 COQ10B coding downstream 284932 1966898 ~ 1977734 (+)
G51110 NA non-coding upstream 22776 1657059 ~ 1657370 (+)
G51062 NA non-coding upstream 197194 1482718 ~ 1482952 (+)
G50937 NA non-coding upstream 199680 1446595 ~ 1480466 (+)
G51125 NA non-coding downstream 58646 1740612 ~ 1863136 (+)
G51188 NA non-coding downstream 167861 1849827 ~ 1854511 (+)
G51193 NA non-coding downstream 183478 1865444 ~ 1865801 (+)
G51194 NA non-coding downstream 187676 1869642 ~ 1869855 (+)
G51195 NA non-coding downstream 194016 1875982 ~ 1876208 (+)
G50920 NA other upstream 909913 769841 ~ 770233 (+)
CI01000009_00094836_00095813 NA other upstream 1584359 94371 ~ 97230 (+)
G51274 NA other downstream 573133 2255099 ~ 2350486 (+)
G51529 NA other downstream 1380067 3062033 ~ 3062587 (+)
CI01000009_03202999_03207060 MPC2, MPC2.S other downstream 1520806 3202207 ~ 3208984 (+)
G53388 NA other downstream 3840276 5522242 ~ 5540638 (+)

Expression


Co-expression Network