G51585


Basic Information

Item Value
gene id G51585
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000009
NCBI id null
chromosome length 16003125
location 3262336 ~ 3262959 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU58775
GCGATCTCTGAGGTCATCACGGCTACCTTTGCGGTCATCGTAGCGATCTCTGAGGTCATCACGGCTACCTTTGCGGTCATCGTAGCGATCTCTGAGGTCATCACGGCTACCTTTGCGGTCATCGAAGCGATCTCTGAGGTCATCACGGTCACCTCCACTGTCATCACTTCGAGCTTTGTCAGTTCTCTCTTCAGTGTTGTATGTATTCCCTACGTCAATATATTCTATTTGTGGTTCGTCGTGGTATTCCACCACTGGAACTTTTTTGATTTCTGTTTCCGTTTGCGGCAACAGCAGATGATGATTATTATGAGCACTGTAGCTCCAGCAATACAACCAGCAACAATGCCTATTGTGGCAAGATTCATAGAGGCTATAAAAACAGAAAGACATGGAAATTAAAAATCAGCACATTAAGCAGGTCAATATTTCACACATTAATCTCAGTAAATTACCATATAATTGTAATGTAATAAACACTTAATTGCT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU58775 True 489 lncRNA 0.42 2 3262336 3262959

Neighbor

gene id symbol gene type direction distance location
CI01000009_03211734_03220047 NXPE3 coding upstream 41029 3211734 ~ 3222297 (+)
CI01000009_03202999_03207060 MPC2, MPC2.S coding upstream 54908 3202207 ~ 3208984 (+)
CI01000009_03164135_03169470 GPR161 coding upstream 92196 3162318 ~ 3170140 (+)
CI01000009_03145417_03159851 F5 coding upstream 102422 3145417 ~ 3159914 (+)
CI01000009_03123137_03137452 CCDC80 coding upstream 124025 3122116 ~ 3138311 (+)
CI01000009_03276572_03283625 POU2F1B, POU2F1 coding downstream 13613 3276572 ~ 3284006 (+)
CI01000009_03301176_03305406 LAMP1 coding downstream 38217 3301176 ~ 3305595 (+)
CI01000009_03313112_03329470 MED14 coding downstream 50153 3313112 ~ 3329510 (+)
CI01000009_03330968_03333405 NA coding downstream 67626 3330585 ~ 3333453 (+)
CI01000009_03335503_03355421 NA coding downstream 72544 3335503 ~ 3355426 (+)
G51581 NA non-coding upstream 327 3261197 ~ 3262009 (+)
G51589 NA non-coding upstream 38471 3222759 ~ 3223865 (+)
G51610 NA non-coding upstream 112904 3119464 ~ 3149432 (+)
G51559 NA non-coding upstream 143316 3118793 ~ 3119020 (+)
G51569 NA non-coding downstream 24369 3287328 ~ 3290810 (+)
G51637 NA non-coding downstream 45567 3308526 ~ 3308759 (+)
G51638 NA non-coding downstream 46119 3309078 ~ 3309537 (+)
G51639 NA non-coding downstream 47995 3310954 ~ 3311469 (+)
G51659 NA non-coding downstream 164607 3427566 ~ 3427773 (+)
G51529 NA other upstream 199749 3062033 ~ 3062587 (+)
G51274 NA other upstream 911850 2255099 ~ 2350486 (+)
CI01000009_01897343_01919208 PIKFYVE other upstream 1360910 1897343 ~ 1919516 (+)
G51122 NA other upstream 1580370 1680146 ~ 1681966 (+)
G53388 NA other downstream 2259283 5522242 ~ 5540638 (+)
CI01000009_05931829_05943829 KCNH3 other downstream 2597343 5931718 ~ 5943899 (+)
G53651 NA other downstream 2982605 6245564 ~ 6248392 (+)
G56100 NA other downstream 5866341 9129300 ~ 9130286 (+)
CI01000009_09853929_09854476 SAP18 other downstream 6590400 9853929 ~ 9856587 (+)

Expression


Co-expression Network