G106646


Basic Information

Item Value
gene id G106646
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035908.1
NCBI id CM008311.1
chromosome length 31403898
location 27906956 ~ 27907211 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU144068
catgctgcttctccatcagcagccagagtccgagagagagagagagagagagagagagagagagagagtacagtaggtcatgctgtttctccatcagcagccagagtccgagagagagagagagagagagagagagagagagagagtacagtaggtcatgctgcttctccatcagcagccagagtccgagagagagagagagtacagtaggtcatgctgcttctccatcagcagccagagtccgagagagagagag

Function

GO: NA

KEGG:

id description
ko04975 Fat digestion and absorption

RNA

RNA id representative length rna type GC content exon number start site end site
TU144068 True 256 lncRNA 0.53 1 27906956 27907211

Neighbor

gene id symbol gene type direction distance location
LOC103043862 mx1 coding upstream 1311 27890718 ~ 27905645 (+)
LOC103047315 LOC108440455 coding upstream 98872 27802084 ~ 27808084 (+)
arglu1 NA coding upstream 138689 27759212 ~ 27768267 (+)
LOC111193461 cpo,LOC108258336 coding upstream 148859 27745088 ~ 27758097 (+)
LOC103046391 NA coding upstream 167858 27729513 ~ 27739098 (+)
LOC111193463 NA coding downstream 86788 27993999 ~ 27999852 (+)
LOC111193464 NA coding downstream 782344 28689555 ~ 28692305 (+)
LOC111193465 NA coding downstream 785633 28692844 ~ 28697096 (+)
LOC111193466 NA coding downstream 794801 28702012 ~ 28702921 (+)
LOC111193571 NA coding downstream 878753 28785964 ~ 28791991 (+)
G106644 NA non-coding upstream 671 27905785 ~ 27906285 (+)
G106636 NA non-coding upstream 80108 27826587 ~ 27826848 (+)
G106572 NA non-coding upstream 272746 27630943 ~ 27634210 (+)
G106562 NA non-coding upstream 282255 27583377 ~ 27624701 (+)
G106564 NA non-coding upstream 296342 27609381 ~ 27610614 (+)
G106648 NA non-coding downstream 5095 27912306 ~ 27914261 (+)
G106642 NA non-coding downstream 8336 27915547 ~ 27918196 (+)
G106650 NA non-coding downstream 19049 27926260 ~ 27936905 (+)
G106651 NA non-coding downstream 29999 27937210 ~ 27975192 (+)
G106674 NA non-coding downstream 200902 28108113 ~ 28111177 (+)
LOC103037236 NA other upstream 1735155 26154417 ~ 26171801 (+)
LOC111193565 NA other upstream 2336135 25458815 ~ 25570821 (+)
LOC111193563 NA other upstream 2537517 25361744 ~ 25369439 (+)
G106146 NA other upstream 3493858 24411208 ~ 24413098 (+)
G106036 NA other upstream 3917364 23987207 ~ 23989592 (+)
G106661 lancl1 other downstream 107305 28014516 ~ 28022047 (+)
G106673 NA other downstream 159141 28066352 ~ 28066983 (+)
LOC103027743 NA other downstream 795856 28703067 ~ 28724026 (+)
LOC111193573 NA other downstream 1241854 29149065 ~ 29159680 (+)
G107117 NA other downstream 1873115 29780326 ~ 29780927 (+)

Expression


Co-expression Network