G53382


Basic Information

Item Value
gene id G53382
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000009
NCBI id null
chromosome length 16003125
location 5408444 ~ 5408764 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU60779
AACACACTATAGATCGATAGATAGATAAATAGATAGATATATTGATTGATTGATTGATACCTCCAGTTTCTCTCTGAATGACTCCACCTGTCTCTTCATCTCATACACAATGGCAGGAGTCTCTGCTGCTTCAGCTAGAATTCTTTTCTCCAGGCTCTGTAACCTGTTTAAAAGTAAATTATGCTGTGAAATAATAATTTTCTACAAATATTTTTATTGGACTTTTTAATTTTATTGTATTTTGGAGTAAAATAAGCGCCAAAGTCTGTGGCACATTTAAATTTTCGTCAACTTCAAGTCCTGCCCTCTCACAAAAACCCC

Function

NR:

description
carboxypeptidase A1-like

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU60779 True 321 lncRNA 0.34 1 5408444 5408764

Neighbor

gene id symbol gene type direction distance location
CI01000009_05384160_05398034 CACNB4A, CACNB4 coding upstream 10407 5384160 ~ 5398037 (+)
CI01000009_05261948_05270622 SEC22A coding upstream 137357 5261948 ~ 5271087 (+)
CI01000009_05194517_05218620 PDIA5 coding upstream 189692 5193998 ~ 5218752 (+)
CI01000009_05106385_05110040 NA coding upstream 298303 5104947 ~ 5110141 (+)
CI01000009_05102641_05105265 NA coding upstream 302633 5102582 ~ 5105811 (+)
CI01000009_05411199_05413237 NIFK coding downstream 2435 5411199 ~ 5413673 (+)
CI01000009_05418094_05487944 CLASP1, CLASP1A coding downstream 9215 5417979 ~ 5488501 (+)
CI01000009_05491807_05498189 TFCP2L1 coding downstream 83043 5491807 ~ 5498799 (+)
CI01000009_05502414_05506275 NA coding downstream 91207 5499971 ~ 5506275 (+)
CI01000009_05522736_05523662 NA coding downstream 113972 5522736 ~ 5523662 (+)
G53338 NA non-coding upstream 6216 5399593 ~ 5402228 (+)
G53352 NA non-coding upstream 40494 5365850 ~ 5367950 (+)
G53257 NA non-coding upstream 363504 5044705 ~ 5044940 (+)
G53256 NA non-coding upstream 363940 5044288 ~ 5044504 (+)
G53255 NA non-coding upstream 364283 5043902 ~ 5044161 (+)
G53383 NA non-coding downstream 693 5409457 ~ 5409673 (+)
G53388 NA non-coding downstream 113478 5522242 ~ 5540638 (+)
G53396 NA non-coding downstream 146006 5554770 ~ 5554990 (+)
G53402 NA non-coding downstream 164870 5573634 ~ 5573866 (+)
G53584 NA non-coding downstream 173693 5582457 ~ 5582685 (+)
CI01000009_03202999_03207060 MPC2, MPC2.S other upstream 2199460 3202207 ~ 3208984 (+)
G51529 NA other upstream 2345857 3062033 ~ 3062587 (+)
G51274 NA other upstream 3057958 2255099 ~ 2350486 (+)
CI01000009_01897343_01919208 PIKFYVE other upstream 3507018 1897343 ~ 1919516 (+)
G51122 NA other upstream 3726478 1680146 ~ 1681966 (+)
CI01000009_05931829_05943829 KCNH3 other downstream 451538 5931718 ~ 5943899 (+)
G53651 NA other downstream 836800 6245564 ~ 6248392 (+)
G56100 NA other downstream 3720536 9129300 ~ 9130286 (+)
CI01000009_09853929_09854476 SAP18 other downstream 4444595 9853929 ~ 9856587 (+)

Expression


Co-expression Network