G57790


Basic Information

Item Value
gene id G57790
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000009
NCBI id null
chromosome length 16003125
location 11787576 ~ 11787784 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU65823
TTCGAAGCATCGTTTTGAAATCGCCCATCACTAGATATTGTGGAATAAAGTCACTATTTTGTTATTTTTGGCACACAAAAAGTATTCTCGTCGCTTTATAATATTAAGGTTAAACCCCTGTAGTCACATGAACATTTTAAATATGTTTTAGTAGCTTTCTGTGCATTGAAAAAGGGAGTGTTATTGCTGGCGATGCAGGCCTCACTGAG

Function

NR:

description
PREDICTED: solute carrier family 12 member 5-like isoform X2

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU65823 True 209 lncRNA 0.36 1 11787576 11787784

Neighbor

gene id symbol gene type direction distance location
CI01000009_11769442_11773619 OSGEPL1 coding upstream 13957 11769442 ~ 11773619 (+)
CI01000009_11761868_11765848 ORMDL1.S, ORMDL1 coding upstream 21245 11761606 ~ 11766944 (+)
CI01000009_11711277_11714191 MSTN, GDF-8, MSTNB coding upstream 72882 11711160 ~ 11714694 (+)
CI01000009_11669960_11702667 HIBCH coding upstream 84037 11669960 ~ 11703539 (+)
CI01000009_11493236_11526914 VWC2L coding upstream 260662 11493236 ~ 11526914 (+)
CI01000009_11789703_11791511 NA coding downstream 1919 11789703 ~ 11791736 (+)
CI01000009_11803818_11808988 SLC40A1 coding downstream 14600 11802384 ~ 11809235 (+)
CI01000009_11835682_11873220 STAT4 coding downstream 47898 11835682 ~ 11873330 (+)
CI01000009_11875722_11882183 STAT1B, STAT1 coding downstream 87702 11875486 ~ 11882921 (+)
CI01000009_11892226_11892558 NA coding downstream 104442 11892226 ~ 11892677 (+)
G57789 NA non-coding upstream 250 11786904 ~ 11787326 (+)
G57787 NA non-coding upstream 7009 11780329 ~ 11780567 (+)
G57786 NA non-coding upstream 9471 11777839 ~ 11778105 (+)
G57772 NA non-coding upstream 29913 11746377 ~ 11757663 (+)
G57665 NA non-coding upstream 121251 11664022 ~ 11666325 (+)
G57719 NA non-coding downstream 27285 11815069 ~ 11822531 (+)
G57792 NA non-coding downstream 46954 11834738 ~ 11834960 (+)
G57813 NA non-coding downstream 150594 11938378 ~ 11938639 (+)
G57724 NA non-coding downstream 379747 12167531 ~ 12168221 (+)
G57737 NA non-coding downstream 383579 12171363 ~ 12172140 (+)
CI01000009_09853929_09854476 SAP18 other upstream 1930989 9853929 ~ 9856587 (+)
G56100 NA other upstream 2657290 9129300 ~ 9130286 (+)
G53651 NA other upstream 5539184 6245564 ~ 6248392 (+)
CI01000009_05931829_05943829 KCNH3 other upstream 5854775 5931718 ~ 5943899 (+)
G57811 NA other downstream 146158 11933942 ~ 11935251 (+)
CI01000009_12432736_12435509 NA other downstream 644774 12432538 ~ 12436017 (+)
G57682 NA other downstream 1037685 12825469 ~ 12892339 (+)
G57691 NA other downstream 1118660 12906444 ~ 12918465 (+)
G57701 NA other downstream 1218859 13006643 ~ 13023138 (+)

Expression


Co-expression Network