G57737


Basic Information

Item Value
gene id G57737
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000009
NCBI id null
chromosome length 16003125
location 12171363 ~ 12172140 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU65768
ATCCACCTTGAATGATACGGTATCACCTGGAACATGACAGGTGTAGTTTCCAGTATCAGACAGTTTGGCTGATTGAACGGTTAGTTTCCTCATATTTCCATCTGTTTGGAAATTGAGCCCAGGGTTTGGGGCCAGCTCTCTACCATCTTTACACCAGAGCACCTGAGCGGTAGCGTCTGATAGCTCACATTTCAGAACAATTGGTGAGTCTACTTCGGTGGACTTGTTCTTCTCCACTTCTGAAATTGGAATGAACTTCAGTGATGGAGCTTGATTTCCACATGGAATGTGATGGTATCATTGTTTGTCTGGCAGCTGTATGTTCCACTGTGACGTAATTTGGCAGTTTGCACAGAGAGTGTTCTCATTGCTTTCTCATTCACAGTGACAAAACCATCTTGAGGAAGCACCTCATTCCCATCTTTGTACCAGCAGACTTGCGCATCAGGGTCTGAGACTTCGCATTGCAGTTTAAAGGGTCTTCCTGACTCAATGCATTTGGTCCGTTGAGCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU65768 True 513 lncRNA 0.45 2 12171363 12172140

Neighbor

gene id symbol gene type direction distance location
CI01000009_12130688_12146560 CTDS1, CTDSP1 coding upstream 24421 12130688 ~ 12146942 (+)
CI01000009_12050866_12109305 SPEG coding upstream 61265 12050773 ~ 12110098 (+)
CI01000009_12028975_12032758 NA coding upstream 138326 12028495 ~ 12033037 (+)
CI01000009_12022660_12022944 NA coding upstream 147975 12022560 ~ 12023388 (+)
CI01000009_11993879_12004644 NEMP2 coding upstream 166598 11993644 ~ 12004765 (+)
CI01000009_12198114_12221988 NA coding downstream 24559 12196699 ~ 12221993 (+)
CI01000009_12249416_12290497 COL18A1 coding downstream 76823 12248963 ~ 12290598 (+)
CI01000009_12351325_12366549 PCBP3 coding downstream 179185 12351325 ~ 12366597 (+)
CI01000009_12387605_12388405 LRRC3 coding downstream 213082 12385222 ~ 12390665 (+)
CI01000009_12432736_12435509 NA coding downstream 260398 12432538 ~ 12436017 (+)
G57724 NA non-coding upstream 3142 12167531 ~ 12168221 (+)
G57813 NA non-coding upstream 232724 11938378 ~ 11938639 (+)
G57792 NA non-coding upstream 336403 11834738 ~ 11834960 (+)
G57719 NA non-coding upstream 348832 11815069 ~ 11822531 (+)
G57790 NA non-coding upstream 383579 11787576 ~ 11787784 (+)
G57850 NA non-coding downstream 16405 12188545 ~ 12188820 (+)
G57704 NA non-coding downstream 133499 12305639 ~ 12372174 (+)
G57733 NA non-coding downstream 153983 12326123 ~ 12350280 (+)
G57871 NA non-coding downstream 228338 12400478 ~ 12401052 (+)
G57811 NA other upstream 236112 11933942 ~ 11935251 (+)
CI01000009_11761868_11765848 ORMDL1.S, ORMDL1 other upstream 404419 11761606 ~ 11766944 (+)
CI01000009_09853929_09854476 SAP18 other upstream 2314776 9853929 ~ 9856587 (+)
G56100 NA other upstream 3041077 9129300 ~ 9130286 (+)
G53651 NA other upstream 5922971 6245564 ~ 6248392 (+)
G57682 NA other downstream 653329 12825469 ~ 12892339 (+)
G57691 NA other downstream 734304 12906444 ~ 12918465 (+)
G57701 NA other downstream 834503 13006643 ~ 13023138 (+)
G58028 NA other downstream 968238 13140378 ~ 13143608 (+)

Expression


Co-expression Network