G58686



Basic Information


Item Value
gene id G58686
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000009
NCBI id null
chromosome length 16003125
location 14720888 ~ 14721094 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU66826
AACGAATAAGCCTCAGGCTGAAGGAAATGCAAATTCATGCCTGTACAGTAGAGGGCACAGTTCAAACAAACAAGCCTTTCAGCTGTGCTGCTATTCTGGACTGCAGGAGTAGTAGTAAATGAGTAAATACAAGCTCACATTTACTCTAGGACTAGTCTACAAAAACCAATAATGTTTACACAGCGTCAACACCTCTGCACTTACTCC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU66826 True 207 lncRNA 0.42 1 14720888 14721094

Neighbor


gene id symbol gene type direction distance location
CI01000009_14682045_14685381 NA coding upstream 35468 14681654 ~ 14685420 (+)
CI01000009_14659692_14664324 NA coding upstream 56555 14659179 ~ 14664333 (+)
CI01000009_14616605_14620028 NA coding upstream 100650 14615371 ~ 14620238 (+)
CI01000009_14595691_14611767 NA coding upstream 108319 14595436 ~ 14612569 (+)
CI01000009_14581261_14582899 NA coding upstream 137894 14580880 ~ 14582994 (+)
CI01000009_14857765_14859526 NA coding downstream 136619 14857713 ~ 14859636 (+)
CI01000009_14862429_14898325 SLC4A3 coding downstream 140638 14861732 ~ 14898549 (+)
CI01000009_14916323_14920716 NA coding downstream 195171 14916265 ~ 14920795 (+)
CI01000009_14925314_14952223 NA coding downstream 203527 14924621 ~ 14952571 (+)
CI01000009_14976078_14977321 NA coding downstream 254677 14975771 ~ 14977424 (+)
G58676 NA non-coding upstream 10748 14704479 ~ 14710140 (+)
G58572 NA non-coding upstream 44515 14610902 ~ 14676373 (+)
G58631 NA non-coding upstream 111547 14609006 ~ 14609341 (+)
G58630 NA non-coding upstream 112822 14607086 ~ 14608066 (+)
G58713 NA non-coding downstream 42728 14763822 ~ 14764679 (+)
G58695 NA non-coding downstream 54843 14775937 ~ 14777316 (+)
G58735 NA non-coding downstream 91922 14813016 ~ 14813280 (+)
G58736 NA non-coding downstream 92303 14813397 ~ 14813661 (+)
G58738 NA non-coding downstream 109869 14830963 ~ 14832195 (+)
G58649 NA other upstream 68866 14649724 ~ 14652022 (+)
G58558 NA other upstream 219374 14496936 ~ 14501514 (+)
G58455 NA other upstream 462362 14246695 ~ 14258526 (+)
G58382 NA other upstream 680987 14039757 ~ 14039901 (+)
G58028 NA other upstream 1577280 13140378 ~ 13143608 (+)
G58711 NA other downstream 45565 14766659 ~ 14773773 (+)
G60028 NA other downstream 630953 15352047 ~ 15376169 (+)
CI01000009_15708273_15712002 METTL5 other downstream 986898 15706460 ~ 15712005 (+)

Expression



Co-expression Network