G184871 (chrna9,LOC107700259,LOC107660492,LOC107548308,LOC107757584,LOC105009502)


Basic Information

Item Value
gene id G184871
gene name chrna9,LOC107700259,LOC107660492,LOC107548308,LOC107757584,LOC105009502
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035917.1
NCBI id CM008320.1
chromosome length 21661149
location 15748657 ~ 15748986 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU250507
AATCAGGGGCACATTTTCTGAGGGAGGCATGCTCTCAGCCACCATCATCTGGAAGACGGTGAGGGCCAGCAGCACAGTGACCCCCAGAGAGACTTTCTCCCCGGAGTCGGCGGGCAGGTAGAAGCCCAGCGGTGCCAGGAAGGAGATGAGGAAGCAGGGCAGCAGCAGGTTGTAGATGTAGAAGGAGGAGCGGCGCTTCAGCAGCACCGTGTACGTGATGTCCGGGTACGGGTCCGAGCAGCATCCATACATGATCACGTTCTTCACGCCCGGCATCCCATGACATTCCCACTCCACGTTCTCCACAAAGTCCGAAAGGTCTCCCCCCTG

Function

symbol description
chrna9 Enables acetylcholine-gated cation-selective channel activity. Acts upstream of or within positive regulation of cytosolic calcium ion concentration. Is integral component of plasma membrane. Part of acetylcholine-gated channel complex.

NR:

description
PREDICTED: neuronal acetylcholine receptor subunit alpha-9-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU250507 True 330 lncRNA 0.59 1 15748657 15748986

Neighbor

gene id symbol gene type direction distance location
pds5a pds5a,LOC107757607 coding downstream 41117 15684816 ~ 15707540 (-)
ugdh ugdh,LOC107757604 coding downstream 89091 15645138 ~ 15659566 (-)
rpl9 rpl9,LOC107671920,LOC107700291,LOC107709470 coding downstream 111565 15632254 ~ 15637092 (-)
rfc1 rfc1,LOC102787736 coding downstream 118652 15616094 ~ 15630005 (-)
LOC103043828 LOC108437730 coding downstream 187825 15428393 ~ 15560832 (-)
gpr75 gpr75,LOC107602942,LOC107683917,LOC107654975,LOC107553188,LOC107705414,LOC107739897 coding upstream 14200 15763186 ~ 15767780 (-)
dctpp1 dctpp1 coding upstream 346044 16095030 ~ 16096320 (-)
fam160a1 fam160a1 coding upstream 370688 16119674 ~ 16141270 (-)
rps3a rps3a,LOC107695588 coding upstream 431084 16180070 ~ 16184812 (-)
mab21l2 mab21l2 coding upstream 602588 16351574 ~ 16356009 (-)
G184870 NA non-coding downstream 4101 15744324 ~ 15744556 (-)
G184869 NA non-coding downstream 15571 15732799 ~ 15733086 (-)
G184868 NA non-coding downstream 15902 15732381 ~ 15732755 (-)
G184865 NA non-coding downstream 22035 15726364 ~ 15726622 (-)
G184863 NA non-coding downstream 26360 15721307 ~ 15722297 (-)
G184874 NA non-coding upstream 22718 15771704 ~ 15772095 (-)
G184881 NA non-coding upstream 142794 15891780 ~ 15946458 (-)
LOC111195237 NA non-coding upstream 192112 15941098 ~ 15966413 (-)
LOC111195239 NA non-coding upstream 243030 15992016 ~ 16093276 (-)
G184898 NA non-coding upstream 265031 16014017 ~ 16014526 (-)
smim14 smim14 other downstream 76703 15666111 ~ 15671954 (-)
smim18 smim18 other downstream 367449 15376658 ~ 15381208 (-)
LOC103043525 tapt1,LOC108434341,LOC107702406,LOC107750443,LOC107671913,LOC105908524 other downstream 408077 15309509 ~ 15340580 (-)
trnas-gcu_6 NA other downstream 1657067 14091509 ~ 14091590 (-)
trnas-gcu_5 NA other downstream 1658870 14089706 ~ 14089787 (-)
lrat lrat other upstream 1149192 16898178 ~ 16901684 (-)
LOC103032582 NA other upstream 1481099 17230085 ~ 17241027 (-)
G185295 NA other upstream 1503281 17252267 ~ 17254633 (-)
G185311 emc4 other upstream 1546515 17295501 ~ 17300782 (-)
nutm1 NA other upstream 1564384 17313370 ~ 17328889 (-)

Expression


Co-expression Network