G185027


Basic Information

Item Value
gene id G185027
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035917.1
NCBI id CM008320.1
chromosome length 21661149
location 16832466 ~ 16832777 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU250720
gtttgttagaggtgttaggagagtaagtgctctttgaagagctctgtcttcaggagtttattaaagatagtgagagattctcctgatctggtagtggaaggtagttagttagaggtgttaggagagtaaatgctctttgaagagctctgtcttcaggaatttcttaaagatagtgagagattctcctgatctggtagtggaaggtagttagttagaggtgttaggagagtaagtgctctttgaagagctctgtcttcaggaatttcttaaagatagtgagagattctcctgatctggtagtggaaggtagtt

Function

GO:

id name namespace
GO:0031667 response to nutrient levels biological_process
GO:0009991 response to extracellular stimulus biological_process
GO:0004982 N-formyl peptide receptor activity molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU250720 True 312 lncRNA 0.40 1 16832466 16832777

Neighbor

gene id symbol gene type direction distance location
gucy1a3 gucy1a3,LOC107572203,LOC107695445,LOC107700279,LOC107598251 coding downstream 5112 16804577 ~ 16827354 (-)
gucy1b3 gucy1b3,LOC107714654,LOC107757623 coding downstream 33718 16765427 ~ 16798748 (-)
fabp2 fabp2,LOC108434304,LOC107714631,LOC107572697,LOC107700317,LOC107695844 coding downstream 75567 16750652 ~ 16756899 (-)
trnar-ccu_39 NA coding downstream 189735 16642659 ~ 16642731 (-)
trnaq-uug_3 NA coding downstream 189863 16642531 ~ 16642603 (-)
npy2r npy2r,LOC107700264 coding upstream 38240 16871017 ~ 16874481 (-)
fhdc1 fhdc1 coding upstream 210098 17042875 ~ 17059662 (-)
LOC103033731 arfip1,LOC108260818,LOC108434328,LOC107745866 coding upstream 256377 17089154 ~ 17113139 (-)
sfrp2 sfrp2 coding upstream 285275 17118052 ~ 17124751 (-)
LOC103027395 ptprdb,LOC107754148 coding upstream 597185 17429962 ~ 17501430 (-)
G184993 NA non-coding downstream 128973 16647410 ~ 16703493 (-)
G185012 myoz2,LOC107695402,LOC103360806,LOC102203409,LOC100711322 non-coding downstream 131158 16699724 ~ 16701308 (-)
G185000 NA non-coding downstream 150609 16677975 ~ 16681857 (-)
G184998 NA non-coding downstream 157457 16674125 ~ 16675009 (-)
G184996 NA non-coding downstream 174874 16655797 ~ 16657592 (-)
G185033 NA non-coding upstream 24614 16857391 ~ 16864206 (-)
G185041 fgg,LOC106602564 non-coding upstream 88259 16921036 ~ 16922494 (-)
G185073 NA non-coding upstream 133232 16966009 ~ 16969764 (-)
G185079 NA non-coding upstream 199354 17032131 ~ 17032392 (-)
G185280 NA non-coding upstream 371964 17204741 ~ 17216109 (-)
smim14 smim14 other downstream 1160512 15666111 ~ 15671954 (-)
smim18 smim18 other downstream 1451258 15376658 ~ 15381208 (-)
LOC103043525 tapt1,LOC108434341,LOC107702406,LOC107750443,LOC107671913,LOC105908524 other downstream 1491886 15309509 ~ 15340580 (-)
trnas-gcu_6 NA other downstream 2740876 14091509 ~ 14091590 (-)
trnas-gcu_5 NA other downstream 2742679 14089706 ~ 14089787 (-)
lrat lrat other upstream 65401 16898178 ~ 16901684 (-)
LOC103032582 NA other upstream 397308 17230085 ~ 17241027 (-)
G185295 NA other upstream 419490 17252267 ~ 17254633 (-)
G185311 emc4 other upstream 462724 17295501 ~ 17300782 (-)
nutm1 NA other upstream 480593 17313370 ~ 17328889 (-)

Expression


Co-expression Network