G81411


Basic Information

Item Value
gene id G81411
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000013
NCBI id null
chromosome length 12551977
location 5621683 ~ 5625346 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU92639
TGATGTTCTCATTAAATCTGGAGCTATCGTCTTTCTCTTCCTGGGTCATATGACACCACTTTTCTCTCGTGGTGGGGGATCTTTTATTTCTCTCACAATGGACGGCATCAAAAAACGCTGCATTCCAAAACCTCAAAGTGTGCCTTTTAAAAAAGGATAAAGAGAAACAGATACAAGCAGACCAACATTAGCATCTATCCGTGACAAATGATCAGACATTGTGAGTGAACAATGTTAGAAAAACATTGTACATTAAACACACCAGCCTCCTTTACTGATAGGCTTCCATTGTAAGTTTTCTGTTTTGTTTTACAAACAAACATTTTATCATTA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU92639 True 333 lncRNA 0.37 2 5621683 5625346

Neighbor

gene id symbol gene type direction distance location
CI01000013_05607381_05608529 FOXL1 coding upstream 13113 5606883 ~ 5608570 (+)
CI01000013_05583328_05584677 B3GNT9 coding upstream 36979 5583328 ~ 5584704 (+)
CI01000013_05572116_05579830 BBS2 coding upstream 41544 5571340 ~ 5580139 (+)
CI01000013_05436977_05445492 NA coding upstream 176191 5436977 ~ 5445492 (+)
CI01000013_05402289_05403494 NA coding upstream 217756 5401587 ~ 5403927 (+)
CI01000013_05636898_05637901 NA coding downstream 11401 5636747 ~ 5638084 (+)
CI01000013_05698947_05741884 ZFPM1 coding downstream 73601 5698947 ~ 5741884 (+)
CI01000013_05808968_05845757 NA coding downstream 183622 5808968 ~ 5846518 (+)
CI01000013_05847899_05849819 NA coding downstream 222553 5847899 ~ 5850194 (+)
CI01000013_05851074_05870330 TANGO6 coding downstream 225728 5851074 ~ 5870870 (+)
G81408 NA non-coding upstream 3572 5617826 ~ 5618111 (+)
G81404 NA non-coding upstream 6433 5614904 ~ 5615250 (+)
G81306 NA non-coding upstream 43035 5513292 ~ 5578648 (+)
G81380 NA non-coding upstream 82739 5491058 ~ 5538944 (+)
G81250 NA non-coding upstream 341745 5279573 ~ 5279938 (+)
G81412 NA non-coding downstream 4284 5629630 ~ 5630428 (+)
G81322 NA non-coding downstream 32190 5657536 ~ 5672245 (+)
G81421 NA non-coding downstream 123440 5748786 ~ 5749042 (+)
G81608 NA non-coding downstream 136013 5761359 ~ 5761564 (+)
G81615 NA non-coding downstream 142953 5768299 ~ 5768506 (+)
G80845 NA other upstream 785451 4835078 ~ 4836232 (+)
CI01000013_04051081_04064651 NA other upstream 1555854 4050837 ~ 4065829 (+)
G80062 NA other upstream 2036899 3584008 ~ 3584784 (+)
G79309 NA other upstream 3154512 2466765 ~ 2467171 (+)
G77695 NA other upstream 4668714 946521 ~ 952969 (+)
CI01000013_06050285_06059640 NA other downstream 430952 6049864 ~ 6060269 (+)
CI01000013_06076169_06080164 NA other downstream 453216 6075400 ~ 6081684 (+)
G81994 NA other downstream 1710599 7335945 ~ 7338239 (+)
G82168 NA other downstream 2402992 8028338 ~ 8041343 (+)
G82581 NA other downstream 3703983 9329329 ~ 9334948 (+)

Expression


Co-expression Network