G52503 (polr2a)


Basic Information

Item Value
gene id G52503
gene name polr2a
gene type unknown
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035902.1
NCBI id CM008305.1
chromosome length 52532229
location 16226236 ~ 16227174 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU70803
AGCTCCGCTCTGCTCATTTCGTCTGAGCTGGTTATTAATTTTGACGATGTCCGCTAGCTTGTGCGTCAAGTCATCCTGGTTTCTAGCAGAGCCCTGCATGACCACAGCAGGTCGGACAGCGAGGGGGGGCACAGGCAGCACAGTGACGATCATCCACTCCGGCCGAGCGTATTTGGGGTCCATGCCCAGGATGAGGTCCTCCTCGTCAGAGATGCGTTTGAAAATCTCGTGGACGCGTTCGGGGCTGAGGAGGATCTTCTTCTCCTGGGAATCTTCATTAACGTGCTTCCACTCGGCGTACAGCTCCAGACCAGAGCGCCGGATACGAGGCTGGTACCGCCCACAGCCACC

Function

symbol description
polr2a Predicted to enable DNA binding activity; metal ion binding activity; and nucleotidyltransferase activity. Predicted to contribute to RNA polymerase II activity. Predicted to act upstream of or within transcription by RNA polymerase II. Predicted to be located in nucleus. Predicted to be part of RNA polymerase II, core complex. Is expressed in blastomere. Orthologous to human POLR2A (RNA polymerase II subunit A).

NR:

description
PREDICTED: DNA-directed RNA polymerase II subunit RPB1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU70803 True 351 TUCP 0.58 2 16226236 16227174

Neighbor

gene id symbol gene type direction distance location
shbg NA coding downstream 66520 16140670 ~ 16159716 (-)
neurl4 neurl4 coding downstream 96860 16086166 ~ 16129376 (-)
LOC103030780 LOC108430129 coding downstream 191140 15980633 ~ 16035096 (-)
LOC103030471 nsfb,LOC108430134,LOC108273757,LOC107665886,LOC107657277 coding downstream 253228 15919470 ~ 15973008 (-)
LOC103031338 rhoc,LOC108427591,LOC105908082,LOC107729745,LOC103035456,LOC108271788,LOC107668165,LOC105902219 coding downstream 870526 15295000 ~ 15355710 (-)
LOC103032046 NA coding upstream 136439 16363613 ~ 16374341 (-)
LOC103024300 mkx,LOC108274364,LOC107665863,LOC107738971,LOC107549415,LOC107584376 coding upstream 595073 16822247 ~ 16928239 (-)
LOC103037795 mpp7,mpp7a,LOC107657298,LOC107665879 coding upstream 962641 17189815 ~ 17464293 (-)
LOC111192622 NA coding upstream 1240877 17468051 ~ 17476591 (-)
LOC103035515 NA coding upstream 1421277 17648451 ~ 17665261 (-)
G52496 NA non-coding downstream 25524 16200209 ~ 16200712 (-)
G52494 NA non-coding downstream 35589 16188251 ~ 16190647 (-)
G52492 NA non-coding downstream 46234 16179519 ~ 16180002 (-)
G52474 NA non-coding downstream 143344 16081235 ~ 16082892 (-)
G52470 NA non-coding downstream 246505 15979473 ~ 15979731 (-)
G52507 polr2a non-coding upstream 9035 16236209 ~ 16238086 (-)
G52506 polr2a,LOC102798520 non-coding upstream 12900 16240074 ~ 16240632 (-)
G52510 NA non-coding upstream 22833 16250007 ~ 16250234 (-)
G52542 NA non-coding upstream 27968 16255142 ~ 16255478 (-)
G52543 NA non-coding upstream 33944 16261118 ~ 16289545 (-)
LOC103028883 LOC108430093 other downstream 6389 16161640 ~ 16219847 (-)
G52493 NA other downstream 40924 16182735 ~ 16185312 (-)
G52299 NA other downstream 1141668 15076296 ~ 15084568 (-)
G52161 NA other downstream 1814625 14408936 ~ 14411611 (-)
G51960 glis1 other downstream 2562122 13663401 ~ 13664114 (-)
LOC111192725 NA other upstream 116582 16343756 ~ 16356960 (-)
zcchc4 NA other upstream 179545 16406719 ~ 16427613 (-)
G52652 NA other upstream 360976 16588150 ~ 16589783 (-)
G53164 NA other upstream 2359227 18586401 ~ 18667287 (-)
LOC103025665 glud1b,LOC108430434,LOC107698813,LOC107700126,LOC107739271,LOC107550058,LOC107749346 other upstream 3295528 19522702 ~ 19570378 (-)

Expression


Co-expression Network