G52506 (polr2a,LOC102798520)


Basic Information

Item Value
gene id G52506
gene name polr2a,LOC102798520
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035902.1
NCBI id CM008305.1
chromosome length 52532229
location 16240074 ~ 16240632 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU70807
CACCGTCTCTTCAAAAGAGCACTTCATGAGCGGTCCTGTGTCTTGTCTGTTGATACCGTGGCGAGTGATGGCCATCAAGTGACCTCTGCAGGTCATCGTGTCACAAAGCAGGGCAAGGTGACGGTAGTTGACATATGAACCGTCAAAGGAGATCACATGGTACAACTCTCTCTCCAGAGCCTTGCGCACCGCCTCGATACCCAGCACAGTAAAGATCTCCACAATGTCGTTGGATGTGGTTCTGACGGGGTCCACGTCCTTTTCGCTGAGGACCCTCATGAGACTGACGCCGTCCGTCTCCAGAATCCACTCCTGCAGGGCTTTAAACTCTCCGTCCTCCGTGATTATGATCTTTTTCTTGTTGTCGGTTTGAGGAAGATGCATGTACACCT

Function

symbol description
polr2a Predicted to enable DNA binding activity; metal ion binding activity; and nucleotidyltransferase activity. Predicted to contribute to RNA polymerase II activity. Predicted to act upstream of or within transcription by RNA polymerase II. Predicted to be located in nucleus. Predicted to be part of RNA polymerase II, core complex. Is expressed in blastomere. Orthologous to human POLR2A (RNA polymerase II subunit A).

NR:

description
PREDICTED: DNA-directed RNA polymerase II subunit RPB1-like, partial

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU70807 True 392 lncRNA 0.52 2 16240074 16240632

Neighbor

gene id symbol gene type direction distance location
shbg NA coding downstream 80358 16140670 ~ 16159716 (-)
neurl4 neurl4 coding downstream 110698 16086166 ~ 16129376 (-)
LOC103030780 LOC108430129 coding downstream 204978 15980633 ~ 16035096 (-)
LOC103030471 nsfb,LOC108430134,LOC108273757,LOC107665886,LOC107657277 coding downstream 267066 15919470 ~ 15973008 (-)
LOC103031338 rhoc,LOC108427591,LOC105908082,LOC107729745,LOC103035456,LOC108271788,LOC107668165,LOC105902219 coding downstream 884364 15295000 ~ 15355710 (-)
LOC103032046 NA coding upstream 122981 16363613 ~ 16374341 (-)
LOC103024300 mkx,LOC108274364,LOC107665863,LOC107738971,LOC107549415,LOC107584376 coding upstream 581615 16822247 ~ 16928239 (-)
LOC103037795 mpp7,mpp7a,LOC107657298,LOC107665879 coding upstream 949183 17189815 ~ 17464293 (-)
LOC111192622 NA coding upstream 1227419 17468051 ~ 17476591 (-)
LOC103035515 NA coding upstream 1407819 17648451 ~ 17665261 (-)
G52507 polr2a non-coding downstream 1988 16236209 ~ 16238086 (-)
G52496 NA non-coding downstream 39362 16200209 ~ 16200712 (-)
G52494 NA non-coding downstream 49427 16188251 ~ 16190647 (-)
G52492 NA non-coding downstream 60072 16179519 ~ 16180002 (-)
G52474 NA non-coding downstream 157182 16081235 ~ 16082892 (-)
G52510 NA non-coding upstream 9375 16250007 ~ 16250234 (-)
G52542 NA non-coding upstream 14510 16255142 ~ 16255478 (-)
G52543 NA non-coding upstream 20486 16261118 ~ 16289545 (-)
G52540 LOC107584402,LOC108430072,LOC107733451,LOC107657288,LOC107738984,LOC107556576 non-coding upstream 44420 16285052 ~ 16293072 (-)
G52538 NA non-coding upstream 51784 16292416 ~ 16339967 (-)
G52503 polr2a other downstream 12900 16226236 ~ 16227174 (-)
LOC103028883 LOC108430093 other downstream 20227 16161640 ~ 16219847 (-)
G52493 NA other downstream 54762 16182735 ~ 16185312 (-)
G52299 NA other downstream 1155506 15076296 ~ 15084568 (-)
G52161 NA other downstream 1828463 14408936 ~ 14411611 (-)
LOC111192725 NA other upstream 103124 16343756 ~ 16356960 (-)
zcchc4 NA other upstream 166087 16406719 ~ 16427613 (-)
G52652 NA other upstream 347518 16588150 ~ 16589783 (-)
G53164 NA other upstream 2345769 18586401 ~ 18667287 (-)
LOC103025665 glud1b,LOC108430434,LOC107698813,LOC107700126,LOC107739271,LOC107550058,LOC107749346 other upstream 3282070 19522702 ~ 19570378 (-)

Expression


Co-expression Network