G53199


Basic Information

Item Value
gene id G53199
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035902.1
NCBI id CM008305.1
chromosome length 52532229
location 18848729 ~ 18892877 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU71740
caatcttcattaattgcacattattgcaccagtaagagcagagtgtgaaggttcaattagcagggtaagagcacagttctgctctaaatactgcaatgcacacaacattatgggtgacataccagagttcaaaaggggacaaattgttggtgcacgtcttgctggagcatctgtgaccaagacagcaagtctttgtgatgcatcaagagccacggtatccagggtaatgtcagcataccagcaagaaggaccaaccacatccaacaggattaactgtggatgcaagaggaagctgtctgaaagggatgttcgggtgctaacccggattgtatccaaaaacataaaaccacggctgatcaaatcacgcagaat

Function

GO: NA

KEGG:

id description
ko00520 Amino sugar and nucleotide sugar metabolism
ko04971 Gastric acid secretion
ko04966 Collecting duct acid secretion

RNA

RNA id representative length rna type GC content exon number start site end site
TU71740 True 372 lncRNA 0.45 2 18848729 18892877

Neighbor

gene id symbol gene type direction distance location
LOC111192624 LOC108430317 coding downstream 107425 18730043 ~ 18741304 (-)
LOC103028095 itgb3b,itgb3,LOC108430317,LOC107698806,LOC107706862 coding downstream 120496 18696994 ~ 18728233 (-)
LOC103024498 ndel1a,LOC108430325,LOC107706877,LOC107698805,LOC107582761,LOC107700135 coding downstream 159128 18656832 ~ 18689601 (-)
nat9 nat9 coding downstream 199854 18644455 ~ 18648875 (-)
grem2 grem2,grem2b,LOC107746751,LOC107570400,LOC107659701 coding downstream 238310 18581880 ~ 18610419 (-)
LOC111192707 NA coding upstream 229743 19122620 ~ 19143280 (-)
LOC103025356 NA coding upstream 544756 19437633 ~ 19459375 (-)
LOC103036701 LOC108430450 coding upstream 712678 19605555 ~ 19670670 (-)
LOC103034301 prkcea,LOC108430457,LOC108274197,LOC107550054,LOC107739250,LOC107698816 coding upstream 789514 19682391 ~ 19839582 (-)
LOC103035166 six3b,LOC103035166,LOC108429305,LOC107550037,LOC107698799,LOC107582771,LOC107749382,LOC107739239 coding upstream 1009416 19902293 ~ 19906073 (-)
G53185 LOC108430338 non-coding downstream 62021 18778714 ~ 18786708 (-)
G53168 NA non-coding downstream 150602 18654192 ~ 18698127 (-)
G53175 NA non-coding downstream 201853 18645879 ~ 18646876 (-)
G53139 NA non-coding downstream 445329 18402279 ~ 18403400 (-)
G53135 NA non-coding downstream 449581 18350272 ~ 18399148 (-)
G53209 NA non-coding upstream 34449 18927326 ~ 18927932 (-)
LOC111192726 NA non-coding upstream 224589 19117466 ~ 19120375 (-)
G53227 NA non-coding upstream 276972 19169849 ~ 19171075 (-)
G53234 NA non-coding upstream 325770 19218647 ~ 19219263 (-)
G53317 NA non-coding upstream 376653 19269530 ~ 19301099 (-)
G53164 NA other downstream 181442 18586401 ~ 18667287 (-)
G52652 NA other downstream 2258946 16588150 ~ 16589783 (-)
zcchc4 NA other downstream 2421116 16406719 ~ 16427613 (-)
LOC111192725 NA other downstream 2491769 16343756 ~ 16356960 (-)
G52503 polr2a other downstream 2621555 16226236 ~ 16227174 (-)
LOC103025665 glud1b,LOC108430434,LOC107698813,LOC107700126,LOC107739271,LOC107550058,LOC107749346 other upstream 629825 19522702 ~ 19570378 (-)
G53382 NA other upstream 957073 19849950 ~ 19850350 (-)
G53562 LOC107396020,LOC107670363,LOC105896953,LOC102778633 other upstream 1728692 20621569 ~ 20690422 (-)
G53598 msh2,LOC107728724,LOC107673650,LOC107582784,LOC107550043,LOC107749362,LOC107698830 other upstream 1890861 20783738 ~ 20787618 (-)
G53607 fbxo11,fbxo11b,fbxo11a,LOC107749363,LOC107550041,LOC107728720 other upstream 1924962 20817839 ~ 20819409 (-)

Expression


Co-expression Network