G53607 (fbxo11,fbxo11b,fbxo11a,LOC107749363,LOC107550041,LOC107728720)


Basic Information

Item Value
gene id G53607
gene name fbxo11,fbxo11b,fbxo11a,LOC107749363,LOC107550041,LOC107728720
gene type unknown
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035902.1
NCBI id CM008305.1
chromosome length 52532229
location 20817839 ~ 20819409 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU72277
TCCTGTTCCTTCTGAGTACAGGTGTGCTCCCTGTGGTCACCCATACTCCTGCCAGAGTGTTGCTGTAGACTTCATTCTCCTCGATAACACCCTGGCCCTTCTCGTGCACATAGATGCCTCCATGCTGTCCATCATGGATCTTGTTGTGTCTCACTATAGGGCAGCTGTTAGTTCTGATCTGAATGCCAGCCAGGGCATTTCCATAAATATCGTTTCCCTCTATGAGACCCCTGCCGTCTCCAAATATGTAAACACCTCCTTGGTTTCCATTGAAGATGGCGTTACCCCTAATCGTGGGGTCACTGTTGGAGGTGATCCACACACCAGCAAAATTGTTGGCGTAGATTTTATTCTCTATGAACTGTCCCCGGCCCTTCTCATGGACGTAGATGCCTCCTGTTTGGCCGTGGTGAATTTCACAGCGTACCACCGTGGGGTTGGCGTAGGCCTTCACCTCGAAACCTGCGATCCTGTTTCTGTGGATGTTGCAGCTCTCGAAGTAGCCC

Function

symbol description
fbxo11a Predicted to enable zinc ion binding activity. Predicted to be involved in protein ubiquitination; regulation of apoptotic process; and ubiquitin-dependent protein catabolic process. Predicted to be part of ubiquitin ligase complex. Orthologous to human FBXO11 (F-box protein 11).
fbxo11b Orthologous to human FBXO11 (F-box protein 11).
fbxo11 Enables protein-arginine N-methyltransferase activity. Involved in cellular protein modification process. Located in cytosol; nucleolus; and nucleoplasm.

NR:

description
PREDICTED: F-box only protein 11-like isoform X2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU72277 True 506 TUCP 0.51 3 20817839 20819409

Neighbor

gene id symbol gene type direction distance location
LOC103043231 gch2,LOC108429343,LOC107550032,LOC105896951,LOC106589406 coding downstream 237235 20572412 ~ 20580604 (-)
LOC103047390 NA coding downstream 249644 20562271 ~ 20568195 (-)
pigf pigf,LOC107698824,LOC107582779,LOC107749355,LOC107550047,LOC107728710,LOC107700117 coding downstream 261509 20541864 ~ 20556330 (-)
LOC103047709 LOC108430512,LOC108273982,LOC107582777,LOC107698822 coding downstream 425633 20316016 ~ 20392206 (-)
trnai-uau_7 NA coding downstream 515211 20302535 ~ 20302628 (-)
LOC103027095 LOC108274166 coding upstream 165050 20984459 ~ 21384885 (-)
LOC103044518 LOC108430683 coding upstream 836208 21655617 ~ 21669948 (-)
LOC103047279 NA coding upstream 1011430 21830839 ~ 21870274 (-)
narf narf,LOC107581643 coding upstream 1054080 21873489 ~ 21885441 (-)
ddit4 ddit4 coding upstream 1100120 21919529 ~ 21921617 (-)
G53599 NA non-coding downstream 26342 20791208 ~ 20791497 (-)
G53573 NA non-coding downstream 61954 20755633 ~ 20755885 (-)
G53563 NA non-coding downstream 171330 20620723 ~ 20646509 (-)
G53556 NA non-coding downstream 180548 20636306 ~ 20637291 (-)
G53559 NA non-coding downstream 210247 20606777 ~ 20607592 (-)
G53610 NA non-coding upstream 3490 20822899 ~ 20825641 (-)
G53709 NA non-coding upstream 378104 21197513 ~ 21198057 (-)
G53716 NA non-coding upstream 479051 21298460 ~ 21300545 (-)
G53717 NA non-coding upstream 479422 21298831 ~ 21299286 (-)
G53725 NA non-coding upstream 513652 21333061 ~ 21333780 (-)
G53598 msh2,LOC107728724,LOC107673650,LOC107582784,LOC107550043,LOC107749362,LOC107698830 other downstream 30221 20783738 ~ 20787618 (-)
G53562 LOC107396020,LOC107670363,LOC105896953,LOC102778633 other downstream 127417 20621569 ~ 20690422 (-)
G53382 NA other downstream 967489 19849950 ~ 19850350 (-)
LOC103025665 glud1b,LOC108430434,LOC107698813,LOC107700126,LOC107739271,LOC107550058,LOC107749346 other downstream 1247461 19522702 ~ 19570378 (-)
G53164 NA other downstream 2150552 18586401 ~ 18667287 (-)
G53996 NA other upstream 2271897 23091306 ~ 23091975 (-)
G54205 kif5b,kif5bb,LOC108430866,LOC107753262 other upstream 3521991 24341400 ~ 24351936 (-)
svil NA other upstream 3966842 24786251 ~ 24920590 (-)
jcad NA other upstream 4131203 24950612 ~ 24998120 (-)
fam240a LOC108441996 other upstream 4729941 25549350 ~ 25562139 (-)

Expression


Co-expression Network