G54204 (kif5b,LOC107568141,LOC107654561,LOC107753262)


Basic Information

Item Value
gene id G54204
gene name kif5b,LOC107568141,LOC107654561,LOC107753262
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035902.1
NCBI id CM008305.1
chromosome length 52532229
location 24340011 ~ 24340825 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU73056
GTCCTGTACAATTCGTGGAATGATTCCCATTCCGTCTGGGTCATGCAAATTACCCTCCATAGTGTGTGTTTTGCCAGAAGAGGTTTGCCCATAGGCAAATATTGTGCCGTTATAACCCTCGAGCACATCTTTAACAATCTTCTGAGCGCAGGCATTATACACCTGCTCCTGTGAAGTGTTAGACTGGAAAACACGGTCGAACATGTAGGGCTTCC

Function

symbol description
kif5b Enables identical protein binding activity; microtubule binding activity; and microtubule motor activity. Involved in several processes, including natural killer cell mediated cytotoxicity; positive regulation of protein localization to plasma membrane; and vesicle transport along microtubule. Located in centriolar satellite; cytosol; and vesicle.

NR:

description
PREDICTED: kinesin-1 heavy chain isoform X2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU73056 True 215 lncRNA 0.47 3 24340011 24340825

Neighbor

gene id symbol gene type direction distance location
LOC103023701 LOC103023701,LOC108429359,LOC107597744,LOC101481087,LOC106560865 coding downstream 2275008 22056973 ~ 22065003 (-)
LOC103023380 sar1aa,sar1b,LOC103023380,LOC108429350,LOC107659671,LOC105903360,LOC103362473 coding downstream 2285923 22046496 ~ 22054088 (-)
anapc16 anapc16,cj104 coding downstream 2401563 21933269 ~ 21938448 (-)
ddit4 ddit4 coding downstream 2418394 21919529 ~ 21921617 (-)
narf narf,LOC107581643 coding downstream 2454570 21873489 ~ 21885441 (-)
zeb1 zeb1 coding upstream 153490 24494315 ~ 24607305 (-)
mtpap NA coding upstream 730629 25071454 ~ 25099104 (-)
ppic ppic,LOC107704600,LOC107713556,LOC107566397,LOC107726227,LOC100333141 coding upstream 1044865 25385690 ~ 25390707 (-)
cep120 cep120,zgc:163014,LOC107712640 coding upstream 1110287 25451112 ~ 25471966 (-)
LOC103046226 znf608 coding upstream 1133060 25473885 ~ 25483984 (-)
G54202 NA non-coding downstream 7941 24331608 ~ 24332070 (-)
G54188 NA non-coding downstream 49234 24272991 ~ 24290777 (-)
G54124 NA non-coding downstream 181076 24154603 ~ 24158935 (-)
G54053 NA non-coding downstream 777079 23557500 ~ 23562932 (-)
G54047 NA non-coding downstream 802953 23536824 ~ 23537058 (-)
G54224 NA non-coding upstream 118954 24459779 ~ 24463132 (-)
G54227 NA non-coding upstream 151876 24492701 ~ 24492970 (-)
LOC111192639 NA non-coding upstream 263200 24604025 ~ 24604660 (-)
LOC111192640 NA non-coding upstream 275220 24616045 ~ 24637375 (-)
G54237 NA non-coding upstream 376656 24717481 ~ 24718187 (-)
G53996 NA other downstream 1248036 23091306 ~ 23091975 (-)
G53607 fbxo11,fbxo11b,fbxo11a,LOC107749363,LOC107550041,LOC107728720 other downstream 3520602 20817839 ~ 20819409 (-)
G53598 msh2,LOC107728724,LOC107673650,LOC107582784,LOC107550043,LOC107749362,LOC107698830 other downstream 3552393 20783738 ~ 20787618 (-)
G53562 LOC107396020,LOC107670363,LOC105896953,LOC102778633 other downstream 3649589 20621569 ~ 20690422 (-)
G53382 NA other downstream 4489661 19849950 ~ 19850350 (-)
G54205 kif5b,kif5bb,LOC108430866,LOC107753262 other upstream 575 24341400 ~ 24351936 (-)
svil NA other upstream 445426 24786251 ~ 24920590 (-)
jcad NA other upstream 609787 24950612 ~ 24998120 (-)
fam240a LOC108441996 other upstream 1208525 25549350 ~ 25562139 (-)
LOC103042298 slc35d2 other upstream 2217581 26558406 ~ 26569939 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location