G122923


Basic Information

Item Value
gene id G122923
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000024
NCBI id null
chromosome length 8644187
location 1491851 ~ 1492211 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU139582
TGAGGAGTTGAGAAGAACTTTATTTTGCCATTACATCACTGCAGCATATGTGAGAAGATAAAACCAGCACAGAAGAGAGGAAGTGGAGAGCTCAACAAACATTGTGTTGGATAACAGGTGACATTGTAAATCATGACCATTTCAGAAGACAGATGATCAATTGCGGCTCTTACATTTTTATATATATGAATATCTCACATTTTGACGTTTGGGTTCTTGTTTTCCCATTCAGAAATGATTCCCAACAAAAGAGCATAGTAGTTATTCGTGCTTCTAATCCAAAAATGTCACACACGAAGAAGTTCTGCACTTGCTTAACGCGAGCCGAACGAACAAAACTGAATCCACATGTATTGTGCGT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU139582 True 361 lncRNA 0.38 1 1491851 1492211

Neighbor

gene id symbol gene type direction distance location
CI01000024_01455583_01465466 TMEM198, TMEM198B coding downstream 26274 1455395 ~ 1465577 (-)
CI01000024_01423879_01438170 DNPEP coding downstream 53681 1423691 ~ 1438170 (-)
CI01000024_01405425_01412752 PTPRNB, PTPRN coding downstream 79099 1405075 ~ 1412752 (-)
CI01000024_01258292_01261764 NA coding downstream 229818 1257279 ~ 1262033 (-)
CI01000024_00955186_00965837 NA coding downstream 525781 954717 ~ 966070 (-)
CI01000024_01517836_01518771 CDK5R2A, CDK5R2 coding upstream 24308 1516519 ~ 1519206 (-)
CI01000024_01521726_01530789 WNT6A coding upstream 29311 1521522 ~ 1530789 (-)
CI01000024_01555879_01590626 ASIC4B coding upstream 63668 1555879 ~ 1591305 (-)
CI01000024_01630975_01637097 GMPPA, GMPAA, GMPPAA, GMPPAB coding upstream 138737 1630948 ~ 1637147 (-)
CI01000024_01747187_01758168 INO80DB coding upstream 254830 1747041 ~ 1758168 (-)
G122860 NA non-coding downstream 38995 1444586 ~ 1452856 (-)
G122859 NA non-coding downstream 106526 1381428 ~ 1385325 (-)
G121423 NA non-coding downstream 585907 874427 ~ 905944 (-)
G121415 NA non-coding downstream 643389 845994 ~ 848462 (-)
G121412 NA non-coding downstream 649832 838695 ~ 842019 (-)
G122926 NA non-coding upstream 9364 1501575 ~ 1505218 (-)
G122981 NA non-coding upstream 120625 1612836 ~ 1613067 (-)
G122864 NA non-coding upstream 166542 1658753 ~ 1788836 (-)
G123003 NA non-coding upstream 176823 1669034 ~ 1676190 (-)
G122843 NA non-coding upstream 276850 1769061 ~ 1770250 (-)
CI01000024_00825386_00837898 NA other downstream 665000 824968 ~ 838550 (-)
G123233 NA other upstream 1055249 2547460 ~ 2555036 (-)
CI01000024_03938368_03941795 NA other upstream 2443831 3938315 ~ 3941924 (-)
G125457 NA other upstream 5865026 7357237 ~ 7358104 (-)
G125798 NA other upstream 6483456 7975667 ~ 7976047 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_032684 dre-mir-375-1 non-coding NC_007117.7 CM002890.2 13800093 ~ 13800172 (-)
bowfin (Amia calva) G127229 NA non-coding CM030137.1 CM030137.1 9066840 ~ 9083586 (-)
tiger barb (Puntius tetrazona) G107999 mrpl44 non-coding NC_056713.1 CM032082.1 19216881 ~ 19218097 (+)