G122981



Basic Information


Item Value
gene id G122981
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000024
NCBI id null
chromosome length 8644187
location 1612836 ~ 1613067 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU139643
TCCTCTCTCAAGATCCATTAATGTACTAAAAACATATTTAAATCAGTTCATGTGAGTACAGTGGTTCAATATTAATATTATAAAGCGACAAGAATATTTCCACTTCCTGAAGCAGTGTTTTGAAATCGGCCATCACTATATAAGTCGTTATTTTGTTTTTTTTTGGCGCACCAAAAATATTCTCGTCGCTTTATAATATTAATATTGAACCACTGTACTCACATGAACTGAT

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU139643 True 232 lncRNA 0.31 1 1612836 1613067

Neighbor


gene id symbol gene type direction distance location
CI01000024_01555879_01590626 ASIC4B coding downstream 21531 1555879 ~ 1591305 (-)
CI01000024_01521726_01530789 WNT6A coding downstream 82047 1521522 ~ 1530789 (-)
CI01000024_01517836_01518771 CDK5R2A, CDK5R2 coding downstream 93630 1516519 ~ 1519206 (-)
CI01000024_01455583_01465466 TMEM198, TMEM198B coding downstream 147259 1455395 ~ 1465577 (-)
CI01000024_01423879_01438170 DNPEP coding downstream 174666 1423691 ~ 1438170 (-)
CI01000024_01630975_01637097 GMPPA, GMPAA, GMPPAA, GMPPAB coding upstream 17881 1630948 ~ 1637147 (-)
CI01000024_01747187_01758168 INO80DB coding upstream 133974 1747041 ~ 1758168 (-)
CI01000024_01758848_01767950 NDUFS1 coding upstream 145507 1758574 ~ 1767950 (-)
CI01000024_01813434_01822004 DYTN coding upstream 200339 1813406 ~ 1823279 (-)
CI01000024_01830050_01834086 NA coding upstream 215602 1828669 ~ 1834086 (-)
G122926 NA non-coding downstream 107618 1501575 ~ 1505218 (-)
G122923 NA non-coding downstream 120625 1491851 ~ 1492211 (-)
G122860 NA non-coding downstream 159980 1444586 ~ 1452856 (-)
G122859 NA non-coding downstream 227511 1381428 ~ 1385325 (-)
G121423 NA non-coding downstream 706892 874427 ~ 905944 (-)
G122864 NA non-coding upstream 45686 1658753 ~ 1788836 (-)
G123003 NA non-coding upstream 55967 1669034 ~ 1676190 (-)
G122843 NA non-coding upstream 155994 1769061 ~ 1770250 (-)
G123023 NA non-coding upstream 170125 1783192 ~ 1793132 (-)
G123025 NA non-coding upstream 203968 1817035 ~ 1817249 (-)
CI01000024_00825386_00837898 NA other downstream 785985 824968 ~ 838550 (-)
G123233 NA other upstream 934393 2547460 ~ 2555036 (-)
CI01000024_03938368_03941795 NA other upstream 2322975 3938315 ~ 3941924 (-)
G125457 NA other upstream 5744170 7357237 ~ 7358104 (-)
G125798 NA other upstream 6362600 7975667 ~ 7976047 (-)

Expression



Co-expression Network