G169170


Basic Information

Item Value
gene id G169170
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000034
NCBI id null
chromosome length 5914002
location 552935 ~ 553203 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU192180
TGGACCTCGAGAGTTTGAATGGCTTTGCTCTCACTGAGCCATCGGATTTCATCAACAATATCTTACAGTTTTTTTCAACTGCTTACACACATTTTCAAAACTTTGCCTCTTTTTTTCAAAACTTTACACACAAATCCAAGAATTGCACACACAAAATGCTTCACATCTCTTGCTAAATGAAGCACTGCATTCAAAGTATCACAAACACATTCCTCTGTGGTATGTTCTTGTTCAAAGTCTTAAAACACTATAAATCAATCCAAGGTAGG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU192180 True 269 lncRNA 0.36 1 552935 553203

Neighbor

gene id symbol gene type direction distance location
CI01000034_00545816_00547683 NA coding upstream 4421 545816 ~ 548514 (+)
CI01000034_00520790_00525323 DDX5 coding upstream 27362 520672 ~ 525573 (+)
CI01000034_00486238_00516732 SMURF2 coding upstream 35411 486238 ~ 517524 (+)
CI01000034_00455762_00459788 KPNA2, IMA2 coding upstream 93008 455145 ~ 459927 (+)
CI01000034_00422322_00453621 BPTF coding upstream 99291 421475 ~ 453644 (+)
CI01000034_00615867_00624387 MIEF1 coding downstream 61755 614958 ~ 625820 (+)
CI01000034_00637189_00642362 NA coding downstream 83767 636970 ~ 642439 (+)
CI01000034_00643011_00645310 RBX1 coding downstream 89698 642901 ~ 645310 (+)
CI01000034_00661553_00677752 XPP3, XPNPEP3 coding downstream 108350 661553 ~ 679148 (+)
CI01000034_00683973_00725610 EP300, EP300B coding downstream 130770 683973 ~ 725905 (+)
G169117 NA non-coding upstream 356187 196392 ~ 196748 (+)
G169052 NA non-coding upstream 450895 101049 ~ 102040 (+)
G169087 NA non-coding upstream 480969 66609 ~ 71966 (+)
G169083 NA non-coding upstream 508299 44301 ~ 44636 (+)
G169064 NA non-coding upstream 509776 14185 ~ 43159 (+)
G169172 NA non-coding downstream 1984 555187 ~ 556623 (+)
G169173 NA non-coding downstream 3525 556728 ~ 556959 (+)
G169174 NA non-coding downstream 3904 557107 ~ 559241 (+)
G169220 NA non-coding downstream 34700 587903 ~ 588144 (+)
G169221 NA non-coding downstream 36651 589854 ~ 590199 (+)
G169309 NA other downstream 416058 969261 ~ 969921 (+)
G169357 NA other downstream 550337 1053543 ~ 1119019 (+)
G169394 NA other downstream 597094 1150297 ~ 1193560 (+)
G169340 NA other downstream 697016 1250219 ~ 1310878 (+)

Expression


Co-expression Network