G169569


Basic Information

Item Value
gene id G169569
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000034
NCBI id null
chromosome length 5914002
location 1606766 ~ 1606974 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU192642
TTATATAATTCGTTTATAAATTAGGCTGTATTATTAGGCTGTATAATATAAACACTGGCTATGTTAATTTAACACTGCAGTGTTTATTATTAGATAATTGATTCATAAATACATTGTCATTAATTTATTTATTTGCTGTTTAAGTAATTCATTATTACATCTAAACTATCATCTACTATTATTAGCATAAGCTTAAACGTTCTTCTGAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU192642 True 209 lncRNA 0.23 1 1606766 1606974

Neighbor

gene id symbol gene type direction distance location
CI01000034_01383935_01395565 NA coding upstream 210318 1383591 ~ 1396448 (+)
CI01000034_01305634_01306636 NA coding upstream 299922 1305634 ~ 1306844 (+)
CI01000034_01210160_01223724 NA coding upstream 382897 1210160 ~ 1223869 (+)
CI01000034_01139725_01146104 BAIAP2L2A coding upstream 460442 1139725 ~ 1146324 (+)
CI01000034_01124686_01125224 NA coding upstream 480569 1124686 ~ 1126197 (+)
CI01000034_01632580_01633233 NA coding downstream 25028 1632002 ~ 1633525 (+)
CI01000034_01637348_01637904 NA coding downstream 29637 1636611 ~ 1638009 (+)
CI01000034_01657515_01658817 NA coding downstream 50236 1657210 ~ 1659106 (+)
CI01000034_01729413_01730790 EVE1 coding downstream 122439 1729413 ~ 1731179 (+)
CI01000034_01764505_01767882 ATP5G1, ATP5G3 coding downstream 157531 1764505 ~ 1767922 (+)
G169565 NA non-coding upstream 1745 1602375 ~ 1605021 (+)
G169561 NA non-coding upstream 15006 1591523 ~ 1591760 (+)
G169345 NA non-coding upstream 195900 1404813 ~ 1410866 (+)
G169461 NA non-coding upstream 237402 1369136 ~ 1369364 (+)
G169570 NA non-coding downstream 553 1607527 ~ 1607834 (+)
G169577 NA non-coding downstream 10785 1617759 ~ 1618038 (+)
G169578 NA non-coding downstream 12125 1619099 ~ 1619375 (+)
G169482 NA non-coding downstream 69523 1676497 ~ 1677646 (+)
G169477 NA non-coding downstream 84056 1691030 ~ 1692070 (+)
G169340 NA other upstream 295888 1250219 ~ 1310878 (+)
G169394 NA other upstream 413206 1150297 ~ 1193560 (+)
G169357 NA other upstream 487747 1053543 ~ 1119019 (+)
G169309 NA other upstream 636845 969261 ~ 969921 (+)
CI01000034_00643011_00645310 RBX1 other upstream 960356 642901 ~ 645310 (+)
G169806 NA other downstream 710999 2317973 ~ 2337690 (+)
CI01000034_03432846_03437608 NDUFA4, NDUFA4L other downstream 1827162 3432846 ~ 3438839 (+)
CI01000034_04125435_04125780 RPRML other downstream 2518126 4125100 ~ 4126825 (+)
CI01000034_04192675_04200041 NA other downstream 2587664 4192311 ~ 4200636 (+)

Expression


Co-expression Network