G169696


Basic Information

Item Value
gene id G169696
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000034
NCBI id null
chromosome length 5914002
location 2090405 ~ 2090648 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU192792
ATTAAAGGGATAGTTCACCCAAAAATGAAAATTTGATGTTTATCTGCTTACCCCCAGGGCATCCAAGATGTAGGTGACTTTGTTTCTTCAGTGGAACACAAATGATGATTTTTAACTCCAACCGTTGCGGTCTGTCAGTCATATAATGCATTGAAACGGTAACACCATCTATGAGAATAAAAAAAACATGCACAAACAAATCCAAATTAAACCCTGCGGCTCGTGACGACACATTGATGTCCTA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU192792 True 244 lncRNA 0.39 1 2090405 2090648

Neighbor

gene id symbol gene type direction distance location
CI01000034_01900645_01947187 RAPGEFL1 coding upstream 143218 1900645 ~ 1947187 (+)
CI01000034_01872601_01880795 CASC3 coding upstream 209610 1872601 ~ 1880795 (+)
CI01000034_01862099_01867869 NA coding upstream 222536 1862099 ~ 1867869 (+)
CI01000034_01858418_01860499 NA coding upstream 229320 1858418 ~ 1861085 (+)
CI01000034_01811735_01836960 IGF2BP1 coding upstream 253445 1811467 ~ 1836960 (+)
CI01000034_02231423_02231755 NA coding downstream 140655 2231303 ~ 2232124 (+)
CI01000034_02256162_02260170 NA coding downstream 165117 2255765 ~ 2260464 (+)
CI01000034_02275470_02281951 CYB561 coding downstream 183953 2274601 ~ 2282604 (+)
CI01000034_02421189_02423360 NA coding downstream 330378 2421026 ~ 2423527 (+)
CI01000034_02550332_02552258 NA coding downstream 459684 2550332 ~ 2552839 (+)
G169677 NA non-coding upstream 15496 2074696 ~ 2074909 (+)
G169656 NA non-coding upstream 84965 2005068 ~ 2005440 (+)
G169653 NA non-coding upstream 87152 2002821 ~ 2003253 (+)
G169636 NA non-coding upstream 105488 1983797 ~ 1984917 (+)
G169612 NA non-coding upstream 137046 1952909 ~ 1953359 (+)
G169698 NA non-coding downstream 1251 2091899 ~ 2094617 (+)
G169706 NA non-coding downstream 18874 2109522 ~ 2113332 (+)
G169692 NA non-coding downstream 75836 2166484 ~ 2166926 (+)
G169686 NA non-coding downstream 79531 2170179 ~ 2182145 (+)
G169760 NA non-coding downstream 144360 2235008 ~ 2304098 (+)
CI01000034_01729413_01730790 EVE1 other upstream 359228 1729413 ~ 1731179 (+)
G169340 NA other upstream 779527 1250219 ~ 1310878 (+)
G169394 NA other upstream 896845 1150297 ~ 1193560 (+)
G169357 NA other upstream 971386 1053543 ~ 1119019 (+)
G169309 NA other upstream 1120484 969261 ~ 969921 (+)
G169806 NA other downstream 227325 2317973 ~ 2337690 (+)
CI01000034_03432846_03437608 NDUFA4, NDUFA4L other downstream 1343488 3432846 ~ 3438839 (+)
CI01000034_04125435_04125780 RPRML other downstream 2034452 4125100 ~ 4126825 (+)
CI01000034_04192675_04200041 NA other downstream 2103990 4192311 ~ 4200636 (+)

Expression


Co-expression Network