CI01000037_01965864_01966433 (COA5, CB064)


Basic Information

Item Value
gene id CI01000037_01965864_01966433
gene name COA5, CB064
gene type misc
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000037
NCBI id null
chromosome length 4612320
location 1965603 ~ 1966435 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000037_01965864_01966433.mRNA
GTATAAAATGGCATTATTCAACACTATTTTCAATAAAATTCTTGGAGCTGTGCTGAGATTTGTAAGCCCAAACAAAGAAAACATTCGCGAACTACAATTCCCACAACGCACTTCCGTTCCACTTCCGCACATACGTCATATTTAACATGGCCGCTTTCATAATAATCTCACATTTGACTTATCTGTAGCTTGTTTTGTTCTTTTTGCCACATTTCTAAATCCGTATTTCGCTTAAACTCACTCGGATGAAAGCTCTACAGAATGCCCAAATATTATGAGGATAAAGAGGAAGATGGCCGCGCCTGCGCTGGAGTAAGAGAGGATTTCAAAGCCTGTCTCCTTCAGCATGACTGTGTAGTGAAGGAAGGTAAGAAGCCCAGTGAGTGTCTGAAGGAAGGACATTGCAAAGGCTTGCAGGTGGCTTTCTTTGAGTGCAAGAGATCCATGGTCAGTACATCAGCTGCTGAGATTTTTTTGCGCAGTTTTCTTTTCTGAAA

Function

symbol description
coa5 Predicted to be involved in mitochondrial cytochrome c oxidase assembly. Predicted to be active in mitochondrion. Human ortholog(s) of this gene implicated in fatal infantile cardioencephalomyopathy due to cytochrome c oxidase deficiency 3. Orthologous to human COA5 (cytochrome c oxidase assembly factor 5).

GO:

id name namespace
GO:0005575 cellular_component cellular_component

KEGG:

id description
K18178 COA5, PET191; cytochrome c oxidase assembly factor 5

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000037_01965864_01966433.mRNA False 497 mRNA 0.41 2 1965603 1966435

Neighbor

gene id symbol gene type direction distance location
CI01000037_01925100_01960498 MGAT4A coding upstream 4881 1925100 ~ 1960722 (+)
CI01000037_01890963_01896442 CREG2 coding upstream 69159 1890963 ~ 1896444 (+)
CI01000037_01884695_01885456 NA coding upstream 79973 1884695 ~ 1885630 (+)
CI01000037_01873612_01880555 KIAA1211L coding upstream 85048 1873612 ~ 1880555 (+)
CI01000037_01863914_01867331 MITD1 coding upstream 98167 1863914 ~ 1867436 (+)
CI01000037_02065346_02075634 NA coding downstream 98841 2065276 ~ 2076284 (+)
CI01000037_02087502_02094770 NA coding downstream 121067 2087502 ~ 2095068 (+)
CI01000037_02248789_02250329 POU3F3 coding downstream 282159 2248594 ~ 2251121 (+)
CI01000037_02279319_02280446 GPR45 coding downstream 312723 2279158 ~ 2280756 (+)
CI01000037_02282458_02287205 NA coding downstream 314912 2281347 ~ 2287285 (+)
G175004 NA non-coding upstream 184734 1762794 ~ 1780869 (+)
G175003 NA non-coding upstream 210421 1751814 ~ 1755182 (+)
G174949 NA non-coding upstream 351452 1613876 ~ 1614274 (+)
G174916 NA non-coding upstream 395124 1569917 ~ 1570479 (+)
G174900 NA non-coding upstream 506951 1396347 ~ 1458652 (+)
G175641 NA non-coding downstream 65111 2031546 ~ 2060079 (+)
G175670 NA non-coding downstream 97737 2064172 ~ 2064536 (+)
G175674 NA non-coding downstream 106993 2073428 ~ 2073640 (+)
G175689 NA non-coding downstream 173154 2139589 ~ 2139812 (+)
G175693 NA non-coding downstream 176516 2142951 ~ 2143263 (+)
CI01000037_00987906_00988350 NA other upstream 975844 987859 ~ 989246 (+)
CI01000037_00228809_00230442 NA other upstream 1735207 228809 ~ 230730 (+)
G176346 NA other downstream 873325 2839760 ~ 2840053 (+)
G176377 NA other downstream 1010427 2976862 ~ 3087968 (+)
CI01000037_04213179_04218057 NA other downstream 2246848 4212907 ~ 4218305 (+)

Expression


Co-expression Network