G174828


Basic Information

Item Value
gene id G174828
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000037
NCBI id null
chromosome length 4612320
location 1241797 ~ 1284983 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU198603
TCGTTGCAGCCACGCCCTCTAACCATGTGTGGGCGGGGCCTGTGGAAGGGCAGCAGTTCGTTTCTCTTGGCCTCTGTCATGGCAGTCTGCAGACTCTCTAGAGAGCTGGACTTCTTTAGGCCTAACGTGGGTCCCAACTCAACCCCACCGCTCATAGATGCTGTTCATCACCATGGGGGGCTGAGTGCTGCCATCTGATTGGCCGAGGTGCCCTGCCTGTC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU198603 True 221 lncRNA 0.59 2 1241797 1284983

Neighbor

gene id symbol gene type direction distance location
CI01000037_01098540_01104541 NA coding upstream 136611 1098072 ~ 1105186 (+)
CI01000037_01075201_01076456 NA coding upstream 165308 1073974 ~ 1076489 (+)
CI01000037_00987906_00988350 NA coding upstream 253425 987859 ~ 989246 (+)
CI01000037_00874555_00887437 NA coding upstream 353780 874487 ~ 888017 (+)
CI01000037_00808744_00809273 NA coding upstream 431924 808744 ~ 809873 (+)
CI01000037_01670886_01672687 TBA1A, TUBA1C, TUBA1B.L, TUBA8L3, TUBA4A, TUBA3E.L coding downstream 385903 1670886 ~ 1673145 (+)
CI01000037_01674415_01677266 TBA1A, TUBA1A.S, TUBA8L4, TUBA1A, TUBA8L3, TBA, TUBA4A coding downstream 389110 1674093 ~ 1677407 (+)
CI01000037_01685225_01686624 NA coding downstream 400242 1685225 ~ 1686738 (+)
CI01000037_01690717_01697406 DNAJB2 coding downstream 405734 1690717 ~ 1697794 (+)
CI01000037_01739245_01747048 DES, DESMA coding downstream 454165 1739148 ~ 1747380 (+)
G174826 NA non-coding upstream 2598 1238903 ~ 1239199 (+)
G174825 NA non-coding upstream 3858 1237701 ~ 1237939 (+)
G174789 NA non-coding upstream 8332 1195075 ~ 1233465 (+)
G174758 NA non-coding upstream 154359 1084088 ~ 1087438 (+)
G174776 NA non-coding upstream 158060 1083440 ~ 1083737 (+)
G174900 NA non-coding downstream 111364 1396347 ~ 1458652 (+)
G174916 NA non-coding downstream 284934 1569917 ~ 1570479 (+)
G174949 NA non-coding downstream 328893 1613876 ~ 1614274 (+)
G175003 NA non-coding downstream 466831 1751814 ~ 1755182 (+)
G175004 NA non-coding downstream 477811 1762794 ~ 1780869 (+)
CI01000037_00228809_00230442 NA other upstream 1011401 228809 ~ 230730 (+)
CI01000037_01965864_01966433 COA5, CB064 other downstream 680759 1965603 ~ 1966435 (+)
G176346 NA other downstream 1554777 2839760 ~ 2840053 (+)
G176377 NA other downstream 1691879 2976862 ~ 3087968 (+)

Expression


Co-expression Network