G176294


Basic Information

Item Value
gene id G176294
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000037
NCBI id null
chromosome length 4612320
location 2798212 ~ 2798493 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU200265
ATTAAAACAAGACAATTTCATCGTTAAATATTTGTTTTTACTATATAGTGATCTTTAATTTGGAGGAAGAGAAACTGGGGGAGGGACTTTATTGCGTTGGATGTGTCAGTGTCACTTTGCTCACATCTGATTGGTCCAATTTCGGTTTGAGATCTCTTACCCAGAACATAACCTGCCCTGGAGCAGGTTAGCTGTGGAGCGTAAGTTACTATGGTGATGAACACCGCTAAAAGCCAAGTCACTTTCATGGTACCTAAAACACAGGATTGGCACAAACTAATC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU200265 True 282 lncRNA 0.40 1 2798212 2798493

Neighbor

gene id symbol gene type direction distance location
CI01000037_02755842_02769590 NA coding upstream 27046 2755842 ~ 2771166 (+)
CI01000037_02700254_02707760 GPR89B, GPR89, GPR89A, GPR89B.L coding upstream 89738 2699595 ~ 2708474 (+)
CI01000037_02527352_02576225 TMTOPS2B coding upstream 221508 2526102 ~ 2576704 (+)
CI01000037_02414352_02418569 C6H2ORF40, ECRG4A coding upstream 379460 2414352 ~ 2418752 (+)
CI01000037_02405252_02406221 NA coding upstream 391775 2404783 ~ 2406437 (+)
CI01000037_02907711_02908412 NA coding downstream 108570 2907063 ~ 2908634 (+)
CI01000037_02909777_02910445 NA coding downstream 111107 2909600 ~ 2910489 (+)
CI01000037_02965392_02966406 FAM155A coding downstream 166899 2965392 ~ 2966433 (+)
CI01000037_03102630_03108094 NA coding downstream 304137 3102630 ~ 3109016 (+)
CI01000037_03120937_03121997 ABHD13 coding downstream 322444 3120937 ~ 3122022 (+)
G176292 NA non-coding upstream 128 2797401 ~ 2798084 (+)
G176273 NA non-coding upstream 10650 2786861 ~ 2787562 (+)
G175849 NA non-coding upstream 77242 2715672 ~ 2720970 (+)
G175850 NA non-coding upstream 82701 2669506 ~ 2715511 (+)
G175887 NA non-coding upstream 107123 2690351 ~ 2691089 (+)
G176297 NA non-coding downstream 816 2799309 ~ 2799606 (+)
G176303 NA non-coding downstream 6830 2805323 ~ 2805550 (+)
G176323 NA non-coding downstream 24220 2822713 ~ 2823102 (+)
G176328 NA non-coding downstream 27489 2825982 ~ 2826307 (+)
G176355 NA non-coding downstream 51116 2849609 ~ 2849926 (+)
CI01000037_01965864_01966433 COA5, CB064 other upstream 827821 1965603 ~ 1966435 (+)
G174949 NA other upstream 1183938 1613876 ~ 1614274 (+)
CI01000037_00987906_00988350 NA other upstream 1808453 987859 ~ 989246 (+)
CI01000037_00228809_00230442 NA other upstream 2567816 228809 ~ 230730 (+)
G176346 NA other downstream 41267 2839760 ~ 2840053 (+)
G176377 NA other downstream 178369 2976862 ~ 3087968 (+)
CI01000037_04213179_04218057 NA other downstream 1414790 4212907 ~ 4218305 (+)

Expression


Co-expression Network